Phase 1: PCR Amplification of Genes
From 2006.igem.org
A. Isolating genes for the quorum sensing mechanism from genomic B. subtilis DNA
"1. ComX - pheromone, 168bp Primers: Fwd = CGGAATTCGCTCTAGATGCAAGACCTAATTAACTACTTTTTAAATTATCC Rev = GACTGCAGCTACTAGTTAATCACCCCATTGACGGGTTATTGG Notes: Forward primer contains EcoRI and XbaI cut sites; Reverse primer contains SpeI and PstI cut sites Amplification of ComX alone was unsuccessful. However, ComQ and ComX are adjacent on the genome so we subsequently amplified them together"