Biobricks
From 2006.igem.org
Construction So Far
Devices Created
| Parts | Part No. | Function | Status |
| E. coli ArsR to LacZ | J33203 | pH lowering output in response to raised arsenate concentration | Working |
| B. subtilis ArsR to LacZ | J33206 | As Above | Background activity too high |
| B. subtilis ArsR to lambda cI repressor | n/a | To repress the hybrid promoter in response to lower levels of arsenate | Done but untested |
| GFP to Terminator | n/a | Testing ArsR function if can't get pH response | Done but not ligated to either ArsR |
Biobricks Constructed By Us
| Biobrick | Part No. | Construction | Ligations | Testing | Sequencing | Use |
| E. coli ArsR | J33201 | Complete | To LacZ | Working | Done | Detection of Arsenic |
| B. subtilis ArsR | n/a | Complete | To LacZ | Tests Underway | biobrick suffix not correct, not in biobrick form | Detection of Arsenic |
| LacZ' | J33202 | Complete | To ArsR and Terminator | Working | Done | Lowering pH/Reporting |
| Bacillus Urease | n/a | Site specific mutagenesis required to remove EcoRI and SpeI sites | To ligate to hybrid promoter | N/A | Not Yet | Raising pH |
| lambda cI/lacI Promoter | J33205 | Complete | To ligate to urease | Planned | Done | Repressed by lambda cI and lacI in absence of lactose |
Parts constructed but not used
| Biobrick | Part No. | Function | |
| xylE from Psuedomonas putida | J33204 | Reporter converting catechol to yellow colour |
Biobricks Taken From Registry
| Biobrick | Number and Location | Ligations | Testing | Use |
| Terminator | BBa_B0015, 1I | To LacZ, plasmid used as vector for most ligations | N/A | Terminating |
| RBS | BBa_B0034, 3O | To ArsR from E. coli | N/A | Ribosome binding site |
| lambda cI | BBa_R0051, 9C | Not yet | Not yet | Repressing hybrid promoter |
| GFP | BBa_E0040, 5H | To Terminator | Not Yet | Testing Promoters |
Primers Etc.
All biobricks have to have the following:
Prefix
(5’) cctttctagag (3’)
Suffix
(5’) tactagtagcggccgctgcagcctt (3’)
Primers used in our procedures
| Name | Sequence | Use | Worked? | Sites |
| Ecarsf1 | cctttctagagccaactcaaaattcac | E. coli arsR for J33201 | yes | XbaI |
| Ecarsr1 | aaggctgcagcggccgctactagtacccggataaaacacatc | E. coli arsR for J33201 | yes | SpeI, NotI, PstI |
| laczf1 | cctttctagaggaggaaacagctatgacc | E. coli lacZ' for J33202 | yes | XbaI |
| laczr1 | aaggctgcagcggccgctactagtatcactccagccagctttc | E. coli lacZ' for J33202 | yes | SpeI, NotI, PstI |
| laczf2 | ggtctagagctcatgttatatcccg | E. coli lacZ' for J33207 | yes | XbaI, SacI |
| Bsarsf2 | atgagctccgttgctgtagtagc | B. subtilis arsR for J33206 | yes | SacI |
| Bsarsr2 | aaactagtttagcagcaatctccttc | B. subtilis arsR for J33206 | yes | SpeI |
| Ppxylef2 | ctgagctcatgaactatgaagaggtg | P. putida xylE for J33204 | yes | SacI |
| Ppxyler2 | taactagtaccggaccatcaggtc | P. putida xylE for J33204 | yes | SpeI |
| Bsuref1 | gagagctccgcaaattcgtagtagc | B. subtilis ureABC | yes | SacI |
| Bsurer1 | ctggatccatgggttttgtgcaccg | B. subtilis ureABC | yes | BamHI |
| JAlam2(f) | gtggagctccgttaaatctatcaccgc | lambda PRM-PR region | yes | SacI |
| JAlam1(r) | catctcgagattatcaccgccagagg | lambda PRM-PR region | yes | XhoI |
| JAlac2(f) | gttctcgagaattgtgagcggataac | lac cI binding site | yes | XhoI |
| BBinsf1 | attcgcggccgcttctag | sequencing biobrick inserts | yes | N/A |
| BBinsr1 | tgcagcggccgctactag | sequencing biobrick inserts | yes | N/A |
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]
