Davidson Parts
From 2006.igem.org
Hin gene: Part BBa_J31000
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in bold.
Forward primer
5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttacCagtgcaaattg 3’
Reverse primer
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’
Hin gene with LVA degredation tag
Will have the following primers synthesized so that the Hin gene has a LVA degredation tag.
Forward Primer
- Consists of a BioBrick prefix, four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2], and the first three base pairs of the Hin gene
TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse Primer
- Consists of the Bio Brick suffix, Stop codon, LVA tag and the ,last 20 base pairs of the Hin gene (without the stop codon)
CTGCAGGCGGCCGCTACTAGTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC
Recombinational Enahancer: Part BBa_J3101
Recombinational Enhancer: Part BBa_J3101
These are the oligos that we ordered to make the recombinational enhancer.
AATTCGCGGCCGCTTCTAGATTCGGGTGTCAACAATTGACCAAAATAT
CGATTTACAGCGTAATGCGCTTTCTAGTGCAAATTGTGACCGC
ATTTTACTAGTTGCGGCCGCCTGCA
GGCGGCCGCAACTAGTAAAATGCGGTCACAATTTGCACTAGAA
AGCGCATTACGCTGTAAATCGATATTTTGGTCAATTGTTGACACCCGAATCTAGAAGCGGCCGCG