Hin gene: Part BBa J31000
From 2006.igem.org
Revision as of 18:33, 12 June 2006 by Fizzle6821 (Talk | contribs)
Hin gene: Part BBa_J31000
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in bold.
Forward primer
5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttacCagtgcaaattg 3’
Reverse primer
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’