Biobricks
From 2006.igem.org
(Difference between revisions)
(→Devices Created) |
(→Devices Created) |
||
Line 11: | Line 11: | ||
|- | |- | ||
| B. subtilis ArsR to lambda cI repressor || To repress the hybrid promoter in response to lower levels of arsenate || Done but untested | | B. subtilis ArsR to lambda cI repressor || To repress the hybrid promoter in response to lower levels of arsenate || Done but untested | ||
+ | |- | ||
+ | | GFP to Terminator || Testing ArsR function if can't get pH response || Done but not ligated to either ArsR | ||
|- | |- | ||
|} | |} |
Revision as of 12:05, 29 August 2006
Construction So Far
Devices Created
Parts | Function | Status |
E. coli ArsR to LacZ | pH lowering output in response to raised arsenate concentration | Not Working |
B. subtilis ArsR to LacZ | As Above | Doing again with correct lacZ |
B. subtilis ArsR to lambda cI repressor | To repress the hybrid promoter in response to lower levels of arsenate | Done but untested |
GFP to Terminator | Testing ArsR function if can't get pH response | Done but not ligated to either ArsR |
Biobricks Constructed By Us
Biobrick | Construction | Ligations | Testing | Sequencing | Use |
E. coli ArsR | Complete | To LacZ | Not Working | Not Yet | Detection of Arsenic |
B. subtilis ArsR | Complete | To LacZ | Not Tested | Not Yet | Detection of Arsenic |
LacZ | Complete | To ArsR and Terminator | Tests Underway | Not Yet | Lowering pH/Reporting |
Bacillus Urease | Site specific mutagenesis required | To ligate to hybrid promoter | N/A | Not Yet | Raising pH |
lambda cI/lacI Promoter | Underway | To ligate to urease | N/A | Not yet | Repressed by lambda cI and lacI in absence of lactose |
Biobricks Taken From Registry
Biobrick | Number and Location | Ligations | Testing | Use |
Terminator | BBa_B0015, 1I | To LacZ, plasmid used as vector for most ligations | N/A | Terminating |
RBS | BBa_B0034, 3O | To ArsR from E. coli | N/A | Ribosome binding site |
lambda cI | BBa_R0051, 9C | Not yet | Not yet | Repressing hybrid promoter |
Primers Etc.
All biobricks have to have the following:
Prefix
(5’) cctttctagag (3’)
Suffix
(5’) tactagtagcggccgctgcagcctt (3’)