Biobricks

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
(Biobricks Constructed By Us)
(Biobricks Constructed By Us)
Line 18: Line 18:
|}
|}
 +
=== Biobricks Taken From Registry ===
 +
{| border="1"
 +
|-
 +
| '''Biobrick''' || '''Number and Location''' || '''Ligations''' || '''Testing''' || '''Use'''
 +
|-
 +
| Terminator || BBa_B0015, 1I || To LacZ, plasmid used as vector for most ligations || N/A || Terminating
 +
|-
 +
| RBS || BBa_B0034, 3O || To ArsR from E. coli || N/A || Ribosome binding site
 +
|-
 +
| lambda cI ||  BBa_R0051, 9C || Not yet || Not yet || Repressing hybrid promoter
 +
|-
 +
|}
== Primers Etc. ==
== Primers Etc. ==

Revision as of 14:25, 17 August 2006

Construction So Far

Biobricks Constructed By Us

Biobrick Construction Ligations Testing Sequencing Use
E. coli ArsR Complete To LacZ Not Working Not Yet Detection of Arsenic
B. subtilis ArsR Complete To LacZ Not Tested Not Yet Detection of Arsenic
LacZ Complete To ArsR and Terminator Tests Underway Not Yet Lowering pH/Reporting
Bacillus Urease Site specific mutagenesis required To ligate to hybrid promoter N/A Not Yet Raising pH
lambda cI/lacI Promoter Underway To ligate to urease N/A Not yet Repressed by lambda cI and lacI in absence of lactose

Biobricks Taken From Registry

Biobrick Number and Location Ligations Testing Use
Terminator BBa_B0015, 1I To LacZ, plasmid used as vector for most ligations N/A Terminating
RBS BBa_B0034, 3O To ArsR from E. coli N/A Ribosome binding site
lambda cI BBa_R0051, 9C Not yet Not yet Repressing hybrid promoter

Primers Etc.

All biobricks have to have the following:


Prefix

(5’) cctttctagag (3’)


Suffix

(5’) tactagtagcggccgctgcagcctt (3’)


ArsR with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix

(5’) cctttctagag ccaactcaaaattcacac (3’)


Back primer sequence with Biobrick suffix

(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)


LacZ with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix

(5’) cctttctagag gaaacagctatgaccatg (3’)


Back primer sequence with Biobrick suffix

(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)


Main page

Personal tools
Past/present/future years