Biobricks

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
(Biobricks Taken From Registry)
(Biobricks Constructed By Us)
Line 21: Line 21:
| '''Biobrick''' || '''Construction''' || '''Ligations''' || '''Testing''' || '''Sequencing''' || '''Use'''
| '''Biobrick''' || '''Construction''' || '''Ligations''' || '''Testing''' || '''Sequencing''' || '''Use'''
|-
|-
-
| E. coli ArsR || Complete || To LacZ || Not Working || Not Yet || Detection of Arsenic
+
| E. coli ArsR || Complete || To LacZ || Working || Done || Detection of Arsenic
|-
|-
-
| B. subtilis ArsR || Complete || To LacZ || Not Tested || Not Yet || Detection of Arsenic
+
| B. subtilis ArsR || Complete || To LacZ || Tests Underway || Done || Detection of Arsenic
|-
|-
-
| LacZ || Complete || To ArsR and Terminator || Tests Underway || Not Yet || Lowering pH/Reporting
+
| LacZ || Complete || To ArsR and Terminator || Working || Done || Lowering pH/Reporting
|-
|-
| Bacillus Urease || Site specific mutagenesis required || To ligate to hybrid promoter || N/A || Not Yet || Raising pH
| Bacillus Urease || Site specific mutagenesis required || To ligate to hybrid promoter || N/A || Not Yet || Raising pH
|-
|-
-
| lambda cI/lacI Promoter || Underway || To ligate to urease || N/A || Not yet || Repressed by lambda cI and lacI in absence of lactose
+
| lambda cI/lacI Promoter || Complete || To ligate to urease || Planned || Done || Repressed by lambda cI and lacI in absence of lactose
|-  
|-  
|}
|}

Revision as of 11:57, 23 October 2006

Construction So Far

Devices Created

Parts Function Status
E. coli ArsR to LacZ pH lowering output in response to raised arsenate concentration Not Working
B. subtilis ArsR to LacZ As Above Doing again with correct lacZ
B. subtilis ArsR to lambda cI repressor To repress the hybrid promoter in response to lower levels of arsenate Done but untested
GFP to Terminator Testing ArsR function if can't get pH response Done but not ligated to either ArsR

Biobricks Constructed By Us

Biobrick Construction Ligations Testing Sequencing Use
E. coli ArsR Complete To LacZ Working Done Detection of Arsenic
B. subtilis ArsR Complete To LacZ Tests Underway Done Detection of Arsenic
LacZ Complete To ArsR and Terminator Working Done Lowering pH/Reporting
Bacillus Urease Site specific mutagenesis required To ligate to hybrid promoter N/A Not Yet Raising pH
lambda cI/lacI Promoter Complete To ligate to urease Planned Done Repressed by lambda cI and lacI in absence of lactose

Biobricks Taken From Registry

Biobrick Number and Location Ligations Testing Use
Terminator BBa_B0015, 1I To LacZ, plasmid used as vector for most ligations N/A Terminating
RBS BBa_B0034, 3O To ArsR from E. coli N/A Ribosome binding site
lambda cI BBa_R0051, 9C Not yet Not yet Repressing hybrid promoter
GFP BBa_E0040, 5H To Terminator Not Yet Testing Promoters

Primers Etc.

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

Main page

Personal tools
Past/present/future years