Biobricks

From 2006.igem.org

Revision as of 14:05, 17 August 2006 by Judenich (Talk | contribs)
Jump to: navigation, search

All biobricks have to have the following:


Prefix

(5’) cctttctagag (3’)


Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

Biobrick Construction Ligations Testing Sequencing Use
E. coli ArsR Complete To LacZ Not Working Not Yet Detection of Arsenic
B. subtilis Complete To LacZ Not Tested Not Yet Detection of Arsenic


ArsR with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix

(5’) cctttctagag ccaactcaaaattcacac (3’)


Back primer sequence with Biobrick suffix

(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)


LacZ with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix

(5’) cctttctagag gaaacagctatgaccatg (3’)


Back primer sequence with Biobrick suffix

(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)


Main page

Personal tools
Past/present/future years