http://2006.igem.org/wiki/index.php?title=Special:Contributions/Judenich&feed=atom&limit=50&target=Judenich&year=&month=2006.igem.org - User contributions [en]2024-03-29T11:50:01ZFrom 2006.igem.orgMediaWiki 1.16.5http://2006.igem.org/wiki/index.php/IGEM_NewsIGEM News2006-11-25T15:37:35Z<p>Judenich: /* iGEM 2006 Team News */</p>
<hr />
<div>'''Please add any news that you find to one of the following categories''' (Make sure to include the date and a link)<br />
<br />
<br />
=iGEM 2006 Jamboree News=<br />
Put news about this year's Jamboree here<br />
*[http://science.slashdot.org/article.pl?sid=06/11/06/1913228&threshold=-1 Genetically Engineered Machines Competition] <small>Slashdot.org</small><br />
*[http://www.technologyreview.com/read_article.aspx?id=17716&ch=biotech Bizarre bacterial creations] <small>Technology Review</small><br />
*[http://www.boston.com/news/education/higher/articles/2006/11/05/genetic_jamboree_draws_innovators/ Genetic Jamboree draws innovators] <small>The Boston Globe</small><br />
<br />
<br />
=iGEM 2006 Team News=<br />
Put news about this year's teams here<br />
*[http://news.bbc.co.uk/1/hi/scotland/edinburgh_and_east/6163330.stm Students Craft Arsenic Water Test]<small>BBC News 11/20/06</small><br />
*[http://www2.davidson.edu/common/templates/news/news_tmp01.asp?newsid=7441 Research Team Scores Big for Bio-Computer That Sorts “Burnt Pancakes”]<small>Davidson College News 11/23/06</small><br />
*[http://www.ed.ac.uk/news/061120arsenictest.html Simple Test Could Make World's Water Supplies Safer]<small>University of Edinburgh News & Events 20/11/06</small><br />
*[http://www3.imperial.ac.uk/newsandeventspggrp/imperialcollege/newssummary/news_8-11-2006-16-12-7?newsid=2929 Imperial Students Engineer Success at International Competition]<small>Imperial College News 11/8/06</small><br />
*[http://www.imperial.ac.uk/P8045.htm Imperial pioneers new biological engineering parts] <small>Imperial College News 08/11/06</small><br />
*[http://www.technologyreview.com/BioTech/17790/ Weaving Barrels from DNA] <small>Technology Review 11/15/06</small><br />
<br />
=Previous iGEM News=<br />
Put news about previous iGEM years here<br />
<br />
<br />
<br />
=Other News=<br />
*[http://www.greenbiz.com/news/news_third.cfm?NewsID=34084 Biology as Cultural Artifact] <small>Greenbiz</small> <br />
*[http://www.collegenews.org/x6048.xml Davidson's Campbell Wins Award...] <small>CollegeNews.org</small><br />
*[http://www.economist.com/science/displaystory.cfm?story_id=7854314 Synthetic Biology: Life 2.0] <small>the Economist 8/31/2006</small><br />
*[http://www.nzz.ch/2006/08/23/ft/articleEEA5E.html Organism from Scratch] (in german) <small>Neue Zürcher Zeitung, Switzerland - 08/24/06</small><br />
<br />
<br />
<br />
<br />
<br />
[[Old IGEM News|Archived IGEM News]]</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-11-16T12:38:14Z<p>Judenich: </p>
<hr />
<div>[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
=== '''WINNERS''' ===<br />
<br />
Best Real World Application, Best Poster<br />
<br />
=== '''RUNNERS UP''' ===<br />
<br />
Third Place Best Device<br />
<br />
<h2>[http://2006.igem.org/Edinburgh_summary_page Project description]</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb. A more detailed project summary can be found [http://2006.igem.org/Edinburgh_summary_page here] <br />
''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Progress</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/EdinburghModellingsimple Modelling: alternative formulation]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Urease_ Strategy for Urease Part and Hybrid Promoter]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Planning</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''16/11/06''' Jude, Happy birthday!!<br />
<br />
'''05/11/06''' 1st place for best poster, best real world application and 3rd place for best device!<br />
<br />
'''24/10/06''' We have been invited to the [http://www.biosysbio.com Biosysbio] conference to present our work.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-11-16T12:37:50Z<p>Judenich: /* Welcome to the [http://www.ed.ac.uk University of Edinburgh ] */</p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
=== '''WINNERS''' ===<br />
<br />
Best Real World Application, Best Poster<br />
<br />
=== '''RUNNERS UP''' ===<br />
<br />
Third Place Best Device<br />
<br />
<h2>[http://2006.igem.org/Edinburgh_summary_page Project description]</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb. A more detailed project summary can be found [http://2006.igem.org/Edinburgh_summary_page here] <br />
''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Progress</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/EdinburghModellingsimple Modelling: alternative formulation]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Urease_ Strategy for Urease Part and Hybrid Promoter]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Planning</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''16/11/06''' Jude, Happy birthday!!<br />
<br />
'''05/11/06''' 1st place for best poster, best real world application and 3rd place for best device!<br />
<br />
'''24/10/06''' We have been invited to the [http://www.biosysbio.com Biosysbio] conference to present our work.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-11-16T12:37:11Z<p>Judenich: /* Welcome to the [http://www.ed.ac.uk University of Edinburgh ] */</p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
'''WINNERS'''<br />
Best Real World Application, Best Poster<br />
'''RUNNERS UP'''<br />
Third Place Best Device<br />
<br />
<h2>[http://2006.igem.org/Edinburgh_summary_page Project description]</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb. A more detailed project summary can be found [http://2006.igem.org/Edinburgh_summary_page here] <br />
''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Progress</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/EdinburghModellingsimple Modelling: alternative formulation]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Urease_ Strategy for Urease Part and Hybrid Promoter]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Planning</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''16/11/06''' Jude, Happy birthday!!<br />
<br />
'''05/11/06''' 1st place for best poster, best real world application and 3rd place for best device!<br />
<br />
'''24/10/06''' We have been invited to the [http://www.biosysbio.com Biosysbio] conference to present our work.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/Lab_Work_JulyLab Work July2006-10-31T10:11:29Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Lab_Work_August August]<br />
<br />
===31st July 2006===<br />
The ars insert and the lacZ and terminator containing vector were isolated from a gel, and ligated then transformed into E. coli. A test gel of the lacZ fragment from the original vector, and the lacZ fragment hopefully containing the terminator showed the first ligation was successful. Finally, today's ligation was transformed into E.coli.<br />
<br />
===28th July 2006===<br />
6 minipreps were carried out for each of the two transformations done yesterday, and the inserts were cut out with EcoRI and PstI, the gel showed the ligations were successful, so preparative digestions were carried out on the ars fragment with EcoRI and SbaI and on each of the lacZ fragments with EcoRI and XbaI.<br />
<br />
===27th July 2006===<br />
A large number of colonies were produced from yesterday's work, so 12 cultures were set up from each of the two transformations to be incubated overnight, with minipreps to be done tomorrow.<br />
<br />
===26th July 2006===<br />
Digestions were carried out on the 1I terminator containing vector with EcoRI and XbaI, and on the LacZ inserts with EcoRI and SpaI. These fragments were ran on a gel, and isolated from the gel to ligate and transform colonies with the LacZ plus terminator plasmid.<br />
<br />
===21st July 2006===<br />
8 minipreps each were carried out on the ''ars'' and the 2 ''lacZ'' plasmids (24 total), along with 2 for vector with no insert as controls. The inserts were then cut out of the plasmids with the EcoRI and the PstI restriction endonucleases. These were run on a gel to identify successful cut fragments, and these will be used next week.<br />
<br />
===20th July 2006===<br />
The transformed colonies grew sucessfully. 8 individual colonies of each were placed in LB+ampicillin media for growing overnight.<br />
<br />
===19th July 2006===<br />
Ars and LacZ PCR fragments with sticky ends were cleaned up, and the vector isolated from a gel. Ligations were set up for two of the lacZ inserts, and the ars insert with a control of no insert. These were transformed into ''E.coli'' and plated.<br />
<br />
===18th July 2006===<br />
Hot weather resulted in general laziness and angst amongst iGEM team. Apart from that, the vector which contained the terminator, and the PCR fragments for Ars genes and new lacZ gene were digested with XbaI and PstI to be ligated tomorrow.<br />
<br />
===17th July 2006===<br />
24 minipreps were carried out on individual colonies that grew after being transformed with the (suspected) ligations between 7K and 30 and 9E and 1I, and cut with EcoRI and PstI to find if the ligation was successful on a gel. The 7K and 30 ligations didn't appear to have been successful, but the 9E and 1I ligation looked to have worked.<br />
<br />
===14th July 2006===<br />
The PCR products from yesterday were ran on a gel, and strong bands found at around 600bp for the arsenic parts, as expected, and these were extracted from the gel. The lacZ products resulted in two distinct bands for each different strain, so all four were isolated and extracted from the gel.<br />
<br />
''' Conclusions from pH lab work '''<br />
<br />
# Experiments 1 & 2 indicate that we are using the wrong growth medium, if we want to achieve a neutral pH without lactose present<br />
# A response is indicated after 3.5 - 4 hours, but 90% of final state is achieved somewhere between 400 - 600 min<br />
# In presence of LB medium, without lactose, the pH stabilises at about 8.5<br />
# The maximum pH change was registered at 4.5, from 8.5 to 4.0<br />
# just adding water to the cultures instead of growth medium slows the response time<br />
# Experiment 3 indicates that a 50% culture to growth medium ratio increases the response time<br />
# Experiment 4 indicates that there is a threshold level of lactose necessary for the acid transformation to occur. Once all the lactose has been used, the bacteria revert to converting amino acids to ammonia, raising the pH<br />
# Other than the threshold level of lactose, the concentration of lactose and culture has no effect on the speed or strength of the response.<br />
<br />
===13th July 2006===<br />
We performed ligations with the DNA purified from the colonies transformed on the 6th, 7K (promoter) to 30 (RBS) and 9E (lacZ) to 1I (terminator). The recombinant plasmids were transformed (hopefully) into competent cells and plated on medium containing Xgal and IPTG, with a pBluescript colony also plated as a control. We also suspended more original colonies in liquid culture as a backup.<br />
<br />
The primers ordered for a better lacZ gene, and the arsR and ars promoter arrived and we did PCR with cells of two different E. coli strains.<br />
<br />
In order to determine the ideal conditions to achieve a pH response, three different growth mediums were established:<br />
<br />
{| border="1"<br />
!width="100"|<br />
!width="100"|<br />
!width="100"|<br />
!width="100"|<br />
|-<br />
| '''Parameter:''' || '''50% culture''' || '''25% culture''' || '''12.5% culture''' <br />
|-<br />
| '''Ampicillin:''' || 50 &mu;l || 50 &mu;l || 50 &mu;l <br />
|-<br />
| '''IPTG:''' || 50 &mu;l || 50 &mu;l || 50 &mu;l <br />
|-<br />
| '''Culture:''' || 25 ml || 12.5 ml || 6.25 ml <br />
|-<br />
| '''Sterile water:''' || 25 ml || 37.5 ml || 43.75 ml <br />
|}<br />
<br />
<br />
From these cultures we achieved the following results:<br />
<br />
{| border="1"<br />
!width="85"|<br />
!width="85"|<br />
!width="85"|<br />
!width="85"|<br />
|-<br />
| '''Parameter:''' || '''50% culture''' (pH) || '''25% culture''' (pH) || '''12.5% culture''' (pH) <br />
|-<br />
| '''Time''' (in min) || || || <br />
|-<br />
| '''0''' || 8.48 || 8.47 || 8.43 <br />
|-<br />
| '''30''' || 8.28 || 8.17 || 7.97 <br />
|-<br />
| '''60''' || 8.18 || 8.05 || 7.85 <br />
|-<br />
| '''90''' || 7.99 || 7.83 || 7.62 <br />
|-<br />
| '''120''' || 7.67 || 7.61 || 7.61 <br />
|-<br />
| '''150''' || 7.53 || 7.49 || 7.54 <br />
|-<br />
| '''180''' || 7.48 || 7.47 || 7.47 <br />
|-<br />
| '''210''' || 7.38 || 7.34 || 7.38 <br />
|-<br />
| '''240''' || 7.33 || 7.33 || 7.46<br />
|}<br />
<br />
<br />
At the end of the experiment the pH meter was tested using pH 7.0 and pH 4.0 buffers. The 4.0 buffer was measured at 3.42 and the 7.0 buffer measured 7.21. Although there is a degree of inaccuracy in the measurements, the electrode was still functioning correctly after the experiments.<br />
<br />
===12th July 2006===<br />
<br />
The pH response over time was again measured but in this experiment, we used liquid cultures which were already saturated (i.e. in the stationary phase). <br />
<br />
{| border="1"<br />
!width="100"|<br />
!width="100"|<br />
!width="100"|<br />
|-<br />
| '''Parameter:''' || '''Blue saturated culture''' || '''White saturated culture''' <br />
|-<br />
| '''Ampicillin:''' || 50 &mu;l || 50 &mu;l <br />
|-<br />
| '''IPTG:''' || 50 &mu;l || 50 &mu;l <br />
|-<br />
| '''Culture:''' || 50 ml || 50 ml <br />
|}<br />
<br />
The results were as follows:<br />
<br />
{| border="1"<br />
!width="85"|<br />
!width="85"|<br />
!width="85"|<br />
|-<br />
| '''Parameter:''' || '''Blue culture''' (pH) || '''White culture''' (pH) <br />
|-<br />
| '''Time''' (in min) || || <br />
|-<br />
| '''0''' || 8.51 || 8.41 <br />
|-<br />
| '''15''' || 8.41 || 8.31 <br />
|-<br />
| '''30''' || 8.33 || 8.24 <br />
|-<br />
| '''45''' || 8.32 || 8.25 <br />
|-<br />
| '''60''' || 8.26 || 8.28 <br />
|-<br />
| '''90''' || 8.05 || 8.28 <br />
|-<br />
| '''120''' || 7.79 || 8.34 <br />
|-<br />
| '''150''' || 7.57 || 8.36 <br />
|-<br />
| '''180''' || 7.37 || 8.33 <br />
|-<br />
| '''210''' || 7.11 || 8.45 <br />
|-<br />
| '''270''' || 6.60 || 8.49<br />
|-<br />
| '''1350''' || 4.03 || 8.30<br />
|}<br />
<br />
===11th July 2006===<br />
<br />
Today we tested the timed pH response in 2 cell cultures: 1 with the LacZ gene, which was activated by IPTG, and one that had this gene absent.<br />
<br />
We cut the isolated plasmid DNA with restriction enzymes to remove the inserts from the promoter and lacZ part, and open the vectors for the RBS and terminator. We ran gels, and these showed that the restriction had succeeded, but had not yielded much DNA. The correct bands were cut out of the gel to purify the inserts and vectors, ready for ligation.<br />
<br />
===10th July 2006===<br />
The colonies transformed on the 6th made it this time, and we isolated the plasmid DNA from three individual colonies for each biobrick. We also transformed some E. coli with <br />
{| border="1"<br />
!width="40"|<br />
!width="100"|<br />
!width="100"|<br />
!width="70"|<br />
|-<br />
| 23E || pSB1A3 || Plasmid || Plate 1 || AmpR<br />
|}<br />
to serve as an empty plasmid for the new LacZ and arsenic promoter/repressor parts which we will create.<br />
<br />
===7th July 2006===<br />
[[Image:DSCN0576.JPG|256px|thumb|left|Acid Production with LacZ and Lactose]]<br />
When bacteria with the lacZ gene inserted are present in a medium containing lactose, the pH does drop significantly.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
===6th July 2006===<br />
<br />
Unfortunately the colonies we plated on the 4th did not survive due to a problem with the competent cells we used, so today we repeated transforming and plating colonies containing the following parts:<br />
<br />
{| border="1"<br />
!width="40"|<br />
!width="100"|<br />
!width="100"|<br />
!width="70"|<br />
|-<br />
| 9E || BBa_E0033 || LacZ alpha || Plate 2 || KanR<br />
|-<br />
| 1I || BBa_B0015 || Terminator || Plate 1 || AmpR<br />
|-<br />
| 7K || BBa_R0010 || IPTG responsive promoter || Plate 1 || AmpR<br />
|-<br />
| 3O || BBa_B0034 || RBS || Plate 1 || AmpR<br />
|}<br />
<br />
===4th July 2006===<br />
<br />
We plated colonies containing plasmids with the following parts:<br />
<br />
{| border="1"<br />
!width="40"|<br />
!width="100"|<br />
!width="100"|<br />
!width="70"|<br />
|-<br />
| 9E || BBa_E0033 || LacZ alpha || Plate 2 || KanR<br />
|-<br />
| 3P || BBa_0010 || Terminator || Plate 2 || AmpR<br />
|-<br />
| 7K || BBa_R0010 || IPTG responsive promoter || Plate 1 || AmpR<br />
|}<br />
<br />
<br />
[http://2006.igem.org/Standard_Protocols Standard Protocols]<br />
<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/Edinburgh_summary_pageEdinburgh summary page2006-10-26T14:01:30Z<p>Judenich: </p>
<hr />
<div><h2>A more detailed summary</h2><br />
<br />
<h3>Brainstorming</h3><br />
In our initial brainstorming sessions, we considered a variety of projects, including a biosensor for detection of water contamination, and a hybrid biological-electrical device such as a variable resistor. Ultimately we decided to combine these two ideas to develop a whole cell biosensor that responds to arsenic by producing a measurable pH change which can be easily detected with a pH electrode.<br />
<br />
<h3>Background</h3><br />
Arsenic contamination in drinking water is a serious problem in many parts of the world, and is particularly associated with Bangladesh and West Bengal, where many tube wells were inadvertently drilled through arsenic bearing sediments, resulting in drinking water contaminated with arsenate and arsenite anions. Consumption of water with elevated arsenic levels over a prolonged period leads to arsenicosis, resulting in skin lesions and various cancers. Many millions of people worldwide are at risk. The current WHO recommended limit for drinking water is 10 ppb arsenic; in many countries a more relaxed limit of 50 ppb is still in operation.<br />
<br />
A simple, cheap and sensitive field assay for arsenic levels would therefore be extremely useful. Arsenic biosensors have been previously reported, but have mainly relied on luminescent or fluorescent reporter genes, which require expensive equipment and trained technicians, and are not really suitable for field use. Other biosensors have used the LacZ/Xgal reporter system, but this is difficult to quantify, and Xgal is expensive and requires refrigeration. By contrast, a sensor giving a pH response would allow a simple quantitative measurement using a cheap pH electrode or solid state device (ISFET), or even just a pH indicator solution giving a colour change.<br />
<br />
<h3>Our system</h3><br />
We devised a system based on the Escherichia coli plasmid-encoded arsenic resistance operon. This is controlled by two repressor proteins, ArsR (responding to low concentrations of arsenate or arsenite) and ArsD (responding to higher concentrations). Each is negatively autoregulated. To induce an increase in pH, we chose to use urease, which breaks down urea, (NH2)2CO, to release ammonium ions. This is used in diagnostic microbiology to distinguish urease-positive bacteria such as Proteus, since the pH can rise above 9. To induce a decrease in pH, we chose to use lacZ. This encodes beta-galactosidase, which catalyses the essential first step in the fermentation of lactose to acetic and lactic acids (mixed acid fermentation) in E. coli and related organisms. This reaction is also used in diagnostic microbiology, since the pH can fall below 4.5.<br />
<br />
In our design, the activity of the biosensor is initiated by exposure to lactose. Urease is expressed from a hybrid promoter repressed by both lambda cI repressor and LacI repressor. In the presence of lactose, but absence of arsenate, urease is induced and the pH rises. When low amounts of arsenate are present, an ArsR-repressed promoter is induced, leading to expression of lambda cI repressor, switching off urease production. Thus the pH remains neutral. If higher amounts of arsenate are present, lacZ expression is induced through an ArsD-responsive promoter, leading to a fall in pH. By using multiple promoters in this way, a high sensitivity and high dynamic range are achieved.<br />
<br />
<h3>The Model</h3><br />
This system was modelled using an ODE-based model, with parameters estimated based on the literature. The model showed good induction of urease and repression of lacZ in the absence of arsenate, and repression of urease and induction of lacZ at high arsenate levels.<br />
<br />
<h3>Building of construct</h3><br />
To demonstrate that a detectable pH change could be achieved in the laboratory, we constructed biobricks bearing the E. coli chrososomal ars promoter and negatively autoregulated arsR gene (BBa_J33201) and the lacZ’ gene encoding the N-terminus of lacZ, which complements the lacZM15 mutation found on the chromosome of laboratory strains of E. coli such as JM109 and XL1Blue (BBa_J33202). These were joined to generate BBa_J33203. Unfortunately, we were not able to obtain template DNA for the plasmid encoded arsR and arsD genes we had intended to use within the time frame of the competition. We therefore also cloned the ars promoter and arsR gene from Bacillus subtilis, to test whether this might have a sufficiently different affinity for arsenate to be useful in this context. This was joined to lacZ’ to generate BBa_J33206. In experiments using JM109/pSB1A2-BBa_J33203, concentrations of arsenate as low as 5 ppb gave a significant decrease in pH at incubation times above 5 hours, persisting to over 20 hours, in a non-optimized medium based on LB with 2% w/v lactose. The equivalent system using BBa_J33206 unfortunately did not show a response to arsenate, with even arsenate-free controls giving a rapid drop in pH, suggesting high background activity due to incomplete repression of this promoter in E. coli. <br />
<br />
<h3>Other Parts</h3><br />
For our system, we also needed a urease part to increase pH in the absence of arsenate. The most obvious choice would have been the urease gene cluster present in some strains of E. coli; however, this is a large chunk of DNA with 7 genes (ureDABCEFG, where ureABC are the genes encoding the urease subunits, and the other genes encode accessory factors required for proper insertion of the nickel cofactor) and contains five forbidden restriction sites which would have to be mutated out individually before the gene cluster could be converted to a biobrick. After searching the literature, we found that the Bacillus subtilis urease gene cluster consists of only three genes, ureABC, which can nevertheless be assembled into a functioning urease in E. coli without the requirement for the usual accessory proteins.Unfortunately, this gene cluster also contains two forbidden restriction sites, EcoRI and SpeI.<br />
<br />
To check that this urease would be suitable for our purposes, the ureABC region was cloned in pGemT-easy (Promega) and pBluescript SK+ (Stratagene). In both constructs, activity was demonstrated in E. coli, with pH rising to 9 after incubation in the presence of 0.2% w/v urea. Having obtained this result, we used site-directed mutagenesis to remove the two forbidden restriction sites. This was successfully achieved, but the mutant gene cluster gave no detectable urease activity. Sequencing revealed a frameshift mutation in ureC. Thus we were unable to generate a urease biobrick during the time available.<br />
<br />
The final part required for our system was the hybrid promoter repressed by both lambda cI and LacI. This was generated by fusing the PRM-PR region of lambda, including cI binding sites OR1, OR2 and OR3, to the 3’ end of the lac promoter region including the LacI binding site. The N-terminal region of lacZ was also included, so that lacZ’ expression could be used to test regulation of the promoter. This biobrick was designated BBa_J33205. Unfortunately, we did not have time to build the constructs necessary to test the regulation of this part.<br />
<br />
Even though we were not able to build our complete design in the time available, we have demonstrated that a simpler version, E. coli JM109/pSB1A2-BBa_J33203, gives a good pH response to arsenate concentrations as low as 5 ppb arsenic, with a dynamic range in the region of 0 to 20 ppb, in a non-optimized system. Recalling that the WHO limit is 10 ppb, this device is suitable for further development, and could potentially be the basis for a cheap and useful sensor to help prevent the ongoing tragedy of chronic arsenic poisoning.<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/Edinburgh_summary_pageEdinburgh summary page2006-10-26T14:01:12Z<p>Judenich: </p>
<hr />
<div><h2>A more detailed summary</h2><br />
<br />
<h3>Brainstorming</h3><br />
In our initial brainstorming sessions, we considered a variety of projects, including a biosensor for detection of water contamination, and a hybrid biological-electrical device such as a variable resistor. Ultimately we decided to combine these two ideas to develop a whole cell biosensor that responds to arsenic by producing a measurable pH change which can be easily detected with a pH electrode.<br />
<br />
<h3>Background</h3><br />
Arsenic contamination in drinking water is a serious problem in many parts of the world, and is particularly associated with Bangladesh and West Bengal, where many tube wells were inadvertently drilled through arsenic bearing sediments, resulting in drinking water contaminated with arsenate and arsenite anions. Consumption of water with elevated arsenic levels over a prolonged period leads to arsenicosis, resulting in skin lesions and various cancers. Many millions of people worldwide are at risk. The current WHO recommended limit for drinking water is 10 ppb arsenic; in many countries a more relaxed limit of 50 ppb is still in operation.<br />
<br />
A simple, cheap and sensitive field assay for arsenic levels would therefore be extremely useful. Arsenic biosensors have been previously reported, but have mainly relied on luminescent or fluorescent reporter genes, which require expensive equipment and trained technicians, and are not really suitable for field use. Other biosensors have used the LacZ/Xgal reporter system, but this is difficult to quantify, and Xgal is expensive and requires refrigeration. By contrast, a sensor giving a pH response would allow a simple quantitative measurement using a cheap pH electrode or solid state device (ISFET), or even just a pH indicator solution giving a colour change.<br />
<br />
<h3>Our system</h3><br />
We devised a system based on the Escherichia coli plasmid-encoded arsenic resistance operon. This is controlled by two repressor proteins, ArsR (responding to low concentrations of arsenate or arsenite) and ArsD (responding to higher concentrations). Each is negatively autoregulated. To induce an increase in pH, we chose to use urease, which breaks down urea, (NH2)2CO, to release ammonium ions. This is used in diagnostic microbiology to distinguish urease-positive bacteria such as Proteus, since the pH can rise above 9. To induce a decrease in pH, we chose to use lacZ. This encodes beta-galactosidase, which catalyses the essential first step in the fermentation of lactose to acetic and lactic acids (mixed acid fermentation) in E. coli and related organisms. This reaction is also used in diagnostic microbiology, since the pH can fall below 4.5.<br />
<br />
In our design, the activity of the biosensor is initiated by exposure to lactose. Urease is expressed from a hybrid promoter repressed by both lambda cI repressor and LacI repressor. In the presence of lactose, but absence of arsenate, urease is induced and the pH rises. When low amounts of arsenate are present, an ArsR-repressed promoter is induced, leading to expression of lambda cI repressor, switching off urease production. Thus the pH remains neutral. If higher amounts of arsenate are present, lacZ expression is induced through an ArsD-responsive promoter, leading to a fall in pH. By using multiple promoters in this way, a high sensitivity and high dynamic range are achieved.<br />
<br />
<h3>The Model</h3><br />
This system was modelled using an ODE-based model, with parameters estimated based on the literature. The model showed good induction of urease and repression of lacZ in the absence of arsenate, and repression of urease and induction of lacZ at high arsenate levels.<br />
<br />
<h3>Building of construct</h3><br />
To demonstrate that a detectable pH change could be achieved in the laboratory, we constructed biobricks bearing the E. coli chrososomal ars promoter and negatively autoregulated arsR gene (BBa_J33201) and the lacZ’ gene encoding the N-terminus of lacZ, which complements the lacZM15 mutation found on the chromosome of laboratory strains of E. coli such as JM109 and XL1Blue (BBa_J33202). These were joined to generate BBa_J33203. Unfortunately, we were not able to obtain template DNA for the plasmid encoded arsR and arsD genes we had intended to use within the time frame of the competition. We therefore also cloned the ars promoter and arsR gene from Bacillus subtilis, to test whether this might have a sufficiently different affinity for arsenate to be useful in this context. This was joined to lacZ’ to generate BBa_J33206. In experiments using JM109/pSB1A2-BBa_J33203, concentrations of arsenate as low as 5 ppb gave a significant decrease in pH at incubation times above 5 hours, persisting to over 20 hours, in a non-optimized medium based on LB with 2% w/v lactose. The equivalent system using BBa_J33206 unfortunately did not show a response to arsenate, with even arsenate-free controls giving a rapid drop in pH, suggesting high background activity due to incomplete repression of this promoter in E. coli. <br />
<br />
<h3>Other Parts</h3><br />
For our system, we also needed a urease part to increase pH in the absence of arsenate. The most obvious choice would have been the urease gene cluster present in some strains of E. coli; however, this is a large chunk of DNA with 7 genes (ureDABCEFG, where ureABC are the genes encoding the urease subunits, and the other genes encode accessory factors required for proper insertion of the nickel cofactor) and contains five forbidden restriction sites which would have to be mutated out individually before the gene cluster could be converted to a biobrick. After searching the literature, we found that the Bacillus subtilis urease gene cluster consists of only three genes, ureABC, which can nevertheless be assembled into a functioning urease in E. coli without the requirement for the usual accessory proteins.Unfortunately, this gene cluster also contains two forbidden restriction sites, EcoRI and SpeI.<br />
<br />
To check that this urease would be suitable for our purposes, the ureABC region was cloned in pGemT-easy (Promega) and pBluescript SK+ (Stratagene). In both constructs, activity was demonstrated in E. coli, with pH rising to 9 after incubation in the presence of 0.2% w/v urea. Having obtained this result, we used site-directed mutagenesis to remove the two forbidden restriction sites. This was successfully achieved, but the mutant gene cluster gave no detectable urease activity. Sequencing revealed a frameshift mutation in ureC. Thus we were unable to generate a urease biobrick during the time available.<br />
<br />
The final part required for our system was the hybrid promoter repressed by both lambda cI and LacI. This was generated by fusing the PRM-PR region of lambda, including cI binding sites OR1, OR2 and OR3, to the 3’ end of the lac promoter region including the LacI binding site. The N-terminal region of lacZ was also included, so that lacZ’ expression could be used to test regulation of the promoter. This biobrick was designated BBa_J33205. Unfortunately, we did not have time to build the constructs necessary to test the regulation of this part.<br />
<br />
Even though we were not able to build our complete design in the time available, we have demonstrated that a simpler version, E. coli JM109/pSB1A2-BBa_J33203, gives a good pH response to arsenate concentrations as low as 5 ppb arsenic, with a dynamic range in the region of 0 to 20 ppb, in a non-optimized system. Recalling that the WHO limit is 10 ppb, this device is suitable for further development, and could potentially be the basis for a cheap and useful sensor to help prevent the ongoing tragedy of chronic arsenic poisoning.<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/Edinburgh_summary_pageEdinburgh summary page2006-10-26T13:58:10Z<p>Judenich: </p>
<hr />
<div><h2>A more detailed summary</h2><br />
<br />
'''Brainstorming'''<br />
In our initial brainstorming sessions, we considered a variety of projects, including a biosensor for detection of water contamination, and a hybrid biological-electrical device such as a variable resistor. Ultimately we decided to combine these two ideas to develop a whole cell biosensor that responds to arsenic by producing a measurable pH change which can be easily detected with a pH electrode.<br />
<br />
'''Background'''<br />
Arsenic contamination in drinking water is a serious problem in many parts of the world, and is particularly associated with Bangladesh and West Bengal, where many tube wells were inadvertently drilled through arsenic bearing sediments, resulting in drinking water contaminated with arsenate and arsenite anions. Consumption of water with elevated arsenic levels over a prolonged period leads to arsenicosis, resulting in skin lesions and various cancers. Many millions of people worldwide are at risk. The current WHO recommended limit for drinking water is 10 ppb arsenic; in many countries a more relaxed limit of 50 ppb is still in operation.<br />
<br />
A simple, cheap and sensitive field assay for arsenic levels would therefore be extremely useful. Arsenic biosensors have been previously reported, but have mainly relied on luminescent or fluorescent reporter genes, which require expensive equipment and trained technicians, and are not really suitable for field use. Other biosensors have used the LacZ/Xgal reporter system, but this is difficult to quantify, and Xgal is expensive and requires refrigeration. By contrast, a sensor giving a pH response would allow a simple quantitative measurement using a cheap pH electrode or solid state device (ISFET), or even just a pH indicator solution giving a colour change.<br />
<br />
'''Our system'''<br />
We devised a system based on the Escherichia coli plasmid-encoded arsenic resistance operon. This is controlled by two repressor proteins, ArsR (responding to low concentrations of arsenate or arsenite) and ArsD (responding to higher concentrations). Each is negatively autoregulated. To induce an increase in pH, we chose to use urease, which breaks down urea, (NH2)2CO, to release ammonium ions. This is used in diagnostic microbiology to distinguish urease-positive bacteria such as Proteus, since the pH can rise above 9. To induce a decrease in pH, we chose to use lacZ. This encodes beta-galactosidase, which catalyses the essential first step in the fermentation of lactose to acetic and lactic acids (mixed acid fermentation) in E. coli and related organisms. This reaction is also used in diagnostic microbiology, since the pH can fall below 4.5.<br />
<br />
In our design, the activity of the biosensor is initiated by exposure to lactose. Urease is expressed from a hybrid promoter repressed by both lambda cI repressor and LacI repressor. In the presence of lactose, but absence of arsenate, urease is induced and the pH rises. When low amounts of arsenate are present, an ArsR-repressed promoter is induced, leading to expression of lambda cI repressor, switching off urease production. Thus the pH remains neutral. If higher amounts of arsenate are present, lacZ expression is induced through an ArsD-responsive promoter, leading to a fall in pH. By using multiple promoters in this way, a high sensitivity and high dynamic range are achieved.<br />
<br />
'''The Model'''<br />
This system was modelled using an ODE-based model, with parameters estimated based on the literature. The model showed good induction of urease and repression of lacZ in the absence of arsenate, and repression of urease and induction of lacZ at high arsenate levels.<br />
<br />
'''Building of construct'''<br />
To demonstrate that a detectable pH change could be achieved in the laboratory, we constructed biobricks bearing the E. coli chrososomal ars promoter and negatively autoregulated arsR gene (BBa_J33201) and the lacZ’ gene encoding the N-terminus of lacZ, which complements the lacZM15 mutation found on the chromosome of laboratory strains of E. coli such as JM109 and XL1Blue (BBa_J33202). These were joined to generate BBa_J33203. Unfortunately, we were not able to obtain template DNA for the plasmid encoded arsR and arsD genes we had intended to use within the time frame of the competition. We therefore also cloned the ars promoter and arsR gene from Bacillus subtilis, to test whether this might have a sufficiently different affinity for arsenate to be useful in this context. This was joined to lacZ’ to generate BBa_J33206. In experiments using JM109/pSB1A2-BBa_J33203, concentrations of arsenate as low as 5 ppb gave a significant decrease in pH at incubation times above 5 hours, persisting to over 20 hours, in a non-optimized medium based on LB with 2% w/v lactose. The equivalent system using BBa_J33206 unfortunately did not show a response to arsenate, with even arsenate-free controls giving a rapid drop in pH, suggesting high background activity due to incomplete repression of this promoter in E. coli. <br />
<br />
'''Other Parts'''<br />
For our system, we also needed a urease part to increase pH in the absence of arsenate. The most obvious choice would have been the urease gene cluster present in some strains of E. coli; however, this is a large chunk of DNA with 7 genes (ureDABCEFG, where ureABC are the genes encoding the urease subunits, and the other genes encode accessory factors required for proper insertion of the nickel cofactor) and contains five forbidden restriction sites which would have to be mutated out individually before the gene cluster could be converted to a biobrick. After searching the literature, we found that the Bacillus subtilis urease gene cluster consists of only three genes, ureABC, which can nevertheless be assembled into a functioning urease in E. coli without the requirement for the usual accessory proteins.Unfortunately, this gene cluster also contains two forbidden restriction sites, EcoRI and SpeI.<br />
<br />
To check that this urease would be suitable for our purposes, the ureABC region was cloned in pGemT-easy (Promega) and pBluescript SK+ (Stratagene). In both constructs, activity was demonstrated in E. coli, with pH rising to 9 after incubation in the presence of 0.2% w/v urea. Having obtained this result, we used site-directed mutagenesis to remove the two forbidden restriction sites. This was successfully achieved, but the mutant gene cluster gave no detectable urease activity. Sequencing revealed a frameshift mutation in ureC. Thus we were unable to generate a urease biobrick during the time available.<br />
<br />
The final part required for our system was the hybrid promoter repressed by both lambda cI and LacI. This was generated by fusing the PRM-PR region of lambda, including cI binding sites OR1, OR2 and OR3, to the 3’ end of the lac promoter region including the LacI binding site. The N-terminal region of lacZ was also included, so that lacZ’ expression could be used to test regulation of the promoter. This biobrick was designated BBa_J33205. Unfortunately, we did not have time to build the constructs necessary to test the regulation of this part.<br />
<br />
Even though we were not able to build our complete design in the time available, we have demonstrated that a simpler version, E. coli JM109/pSB1A2-BBa_J33203, gives a good pH response to arsenate concentrations as low as 5 ppb arsenic, with a dynamic range in the region of 0 to 20 ppb, in a non-optimized system. Recalling that the WHO limit is 10 ppb, this device is suitable for further development, and could potentially be the basis for a cheap and useful sensor to help prevent the ongoing tragedy of chronic arsenic poisoning.<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/Edinburgh_summary_pageEdinburgh summary page2006-10-26T10:44:31Z<p>Judenich: </p>
<hr />
<div><h2>A more detailed summary</h2><br />
<br />
<br />
In our initial brainstorming sessions, we considered a variety of projects, including a biosensor for detection of water contamination, and a hybrid biological-electrical device such as a variable resistor. Ultimately we decided to combine these two ideas to develop a whole cell biosensor that responds to arsenic by producing a measurable pH change which can be easily detected with a pH electrode.<br />
<br />
Arsenic contamination in drinking water is a serious problem in many parts of the world, and is particularly associated with Bangladesh and West Bengal, where many tube wells were inadvertently drilled through arsenic bearing sediments, resulting in drinking water contaminated with arsenate and arsenite anions. Consumption of water with elevated arsenic levels over a prolonged period leads to arsenicosis, resulting in skin lesions and various cancers. Many millions of people worldwide are at risk. The current WHO recommended limit for drinking water is 10 ppb arsenic; in many countries a more relaxed limit of 50 ppb is still in operation.<br />
<br />
A simple, cheap and sensitive field assay for arsenic levels would therefore be extremely useful. Arsenic biosensors have been previously reported, but have mainly relied on luminescent or fluorescent reporter genes, which require expensive equipment and trained technicians, and are not really suitable for field use. Other biosensors have used the LacZ/Xgal reporter system, but this is difficult to quantify, and Xgal is expensive and requires refrigeration. By contrast, a sensor giving a pH response would allow a simple quantitative measurement using a cheap pH electrode or solid state device (ISFET), or even just a pH indicator solution giving a colour change.<br />
<br />
We devised a system based on the Escherichia coli plasmid-encoded arsenic resistance operon. This is controlled by two repressor proteins, ArsR (responding to low concentrations of arsenate or arsenite) and ArsD (responding to higher concentrations). Each is negatively autoregulated. To induce an increase in pH, we chose to use urease, which breaks down urea, (NH2)2CO, to release ammonium ions. This is used in diagnostic microbiology to distinguish urease-positive bacteria such as Proteus, since the pH can rise above 9. To induce a decrease in pH, we chose to use lacZ. This encodes beta-galactosidase, which catalyses the essential first step in the fermentation of lactose to acetic and lactic acids (mixed acid fermentation) in E. coli and related organisms. This reaction is also used in diagnostic microbiology, since the pH can fall below 4.5.<br />
<br />
In our design, the activity of the biosensor is initiated by exposure to lactose. Urease is expressed from a hybrid promoter repressed by both lambda cI repressor and LacI repressor. In the presence of lactose, but absence of arsenate, urease is induced and the pH rises. When low amounts of arsenate are present, an ArsR-repressed promoter is induced, leading to expression of lambda cI repressor, switching off urease production. Thus the pH remains neutral. If higher amounts of arsenate are present, lacZ expression is induced through an ArsD-responsive promoter, leading to a fall in pH. By using multiple promoters in this way, a high sensitivity and high dynamic range are achieved.<br />
<br />
This system was modelled using an ODE-based model, with parameters estimated based on the literature. The model showed good induction of urease and repression of lacZ in the absence of arsenate, and repression of urease and induction of lacZ at high arsenate levels.<br />
<br />
To demonstrate that a detectable pH change could be achieved in the laboratory, we constructed biobricks bearing the E. coli chrososomal ars promoter and negatively autoregulated arsR gene (BBa_J33201) and the lacZ’ gene encoding the N-terminus of lacZ, which complements the lacZM15 mutation found on the chromosome of laboratory strains of E. coli such as JM109 and XL1Blue (BBa_J33202). These were joined to generate BBa_J33203. Unfortunately, we were not able to obtain template DNA for the plasmid encoded arsR and arsD genes we had intended to use within the time frame of the competition. We therefore also cloned the ars promoter and arsR gene from Bacillus subtilis, to test whether this might have a sufficiently different affinity for arsenate to be useful in this context. This was joined to lacZ’ to generate BBa_J33206. In experiments using JM109/pSB1A2-BBa_J33203, concentrations of arsenate as low as 5 ppb gave a significant decrease in pH at incubation times above 5 hours, persisting to over 20 hours, in a non-optimized medium based on LB with 2% w/v lactose. The equivalent system using BBa_J33206 unfortunately did not show a response to arsenate, with even arsenate-free controls giving a rapid drop in pH, suggesting high background activity due to incomplete repression of this promoter in E. coli. <br />
<br />
For our system, we also needed a urease part to increase pH in the absence of arsenate. The most obvious choice would have been the urease gene cluster present in some strains of E. coli; however, this is a large chunk of DNA with 7 genes (ureDABCEFG, where ureABC are the genes encoding the urease subunits, and the other genes encode accessory factors required for proper insertion of the nickel cofactor) and contains five forbidden restriction sites which would have to be mutated out individually before the gene cluster could be converted to a biobrick. After searching the literature, we found that the Bacillus subtilis urease gene cluster consists of only three genes, ureABC, which can nevertheless be assembled into a functioning urease in E. coli without the requirement for the usual accessory proteins.Unfortunately, this gene cluster also contains two forbidden restriction sites, EcoRI and SpeI.<br />
<br />
To check that this urease would be suitable for our purposes, the ureABC region was cloned in pGemT-easy (Promega) and pBluescript SK+ (Stratagene). In both constructs, activity was demonstrated in E. coli, with pH rising to 9 after incubation in the presence of 0.2% w/v urea. Having obtained this result, we used site-directed mutagenesis to remove the two forbidden restriction sites. This was successfully achieved, but the mutant gene cluster gave no detectable urease activity. Sequencing revealed a frameshift mutation in ureC. Thus we were unable to generate a urease biobrick during the time available.<br />
<br />
The final part required for our system was the hybrid promoter repressed by both lambda cI and LacI. This was generated by fusing the PRM-PR region of lambda, including cI binding sites OR1, OR2 and OR3, to the 3’ end of the lac promoter region including the LacI binding site. The N-terminal region of lacZ was also included, so that lacZ’ expression could be used to test regulation of the promoter. This biobrick was designated BBa_J33205. Unfortunately, we did not have time to build the constructs necessary to test the regulation of this part.<br />
<br />
Even though we were not able to build our complete design in the time available, we have demonstrated that a simpler version, E. coli JM109/pSB1A2-BBa_J33203, gives a good pH response to arsenate concentrations as low as 5 ppb arsenic, with a dynamic range in the region of 0 to 20 ppb, in a non-optimized system. Recalling that the WHO limit is 10 ppb, this device is suitable for further development, and could potentially be the basis for a cheap and useful sensor to help prevent the ongoing tragedy of chronic arsenic poisoning.<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-26T10:43:58Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>[http://2006.igem.org/Edinburgh_summary_page Project description]</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb. A more detailed project summary can be found [http://2006.igem.org/Edinburgh_summary_page here] <br />
''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Planning</h2><br />
[http://2006.igem.org/Ureaseetc Strategy for Urease Part and Hybrid Promoter]<br />
<br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-26T10:43:18Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb. A more detailed project summary can be found [http://2006.igem.org/Edinburgh_summary_page here] <br />
''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Planning</h2><br />
[http://2006.igem.org/Ureaseetc Strategy for Urease Part and Hybrid Promoter]<br />
<br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-26T10:43:00Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb. A more detailed project summary can be found [http://2006.igem.org/Edinburgh_summary_page <h2>here] <br />
</h2>''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Planning</h2><br />
[http://2006.igem.org/Ureaseetc Strategy for Urease Part and Hybrid Promoter]<br />
<br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-26T10:42:11Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb. A more detailed project summary can be found in the link below:''[http://2006.igem.org/Edinburgh_summary_page <h2>(Summary page)] <br />
</h2><br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Planning</h2><br />
[http://2006.igem.org/Ureaseetc Strategy for Urease Part and Hybrid Promoter]<br />
<br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T14:22:02Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Planning</h2><br />
[http://2006.igem.org/Ureaseetc Strategy for Urease Part and Hybrid Promoter]<br />
<br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/User:LaszloUser:Laszlo2006-10-25T12:30:12Z<p>Judenich: </p>
<hr />
<div>[[Image:laszlo.jpg|Laszlo Kozma-Bognar]]<br />
<br />
Hi, my name is Laszlo Kozma-Bognar and I work in Prof. Andrew Millar's lab on [http://www.amillar.org plant circadian rhythms]. I'm a molecular biologist and I'll do my best to help the Edinburgh iGEM team at the bench.<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/File:Laszlo.jpgFile:Laszlo.jpg2006-10-25T12:29:09Z<p>Judenich: </p>
<hr />
<div></div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T12:26:42Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Planning</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/Lab_Work_EdinburghLab Work Edinburgh2006-10-25T12:26:05Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Lab_Work_August August and September]<br />
<br />
[http://2006.igem.org/Lab_Work_July July]<br />
<br />
[http://2006.igem.org/Standard_Protocols Standard Protocols]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
[http://2006.igem.org/University_of_Edinburgh Main Page]</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T12:25:47Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T12:25:27Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T12:25:11Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/Lab_Work_EdinburghLab Work Edinburgh2006-10-25T12:24:53Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Lab_Work_August August and September]<br />
<br />
[http://2006.igem.org/Lab_Work_July July]<br />
<br />
[http://2006.igem.org/Standard_Protocols Standard Protocols]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/University_of_Edinburgh Main Page]</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T12:24:40Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T12:24:25Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''24/10/06''' We are invited to BIOSYSBIO[http://www.biosysbio.com] conference to present our work.<br />
<br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T11:35:03Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T11:34:51Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T11:34:19Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T11:34:07Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Notebook Biosensor]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Work Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T11:33:23Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Work Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/Lab_Work_EdinburghLab Work Edinburgh2006-10-25T11:32:41Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Lab_Work_August August and September]<br />
<br />
[http://2006.igem.org/Lab_Work_July July]<br />
<br />
[http://2006.igem.org/Standard_Protocols Standard Protocols]<br />
<br />
[http://2006.igem.org/University_of_Edinburgh Main Page]</div>Judenichhttp://2006.igem.org/wiki/index.php/Lab_Work_EdinburghLab Work Edinburgh2006-10-25T11:31:37Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Lab_Work_August August and September]<br />
<br />
[http://2006.igem.org/Lab_Work_July July]</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T11:30:32Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/Standard_Protocols Standard Protocols]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Lab_Work_Edinburgh Lab Work Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T09:35:02Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/Standard_Protocols Standard Protocols]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modelling]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Lab_Work Lab Work Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/University_of_Edinburgh_2006University of Edinburgh 20062006-10-25T09:34:28Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Edinburgh_City http://parts2.mit.edu/wiki/images/b/bc/Intro.JPG] <br />
<br />
<br />
<br />
[[Image:Edinburgh_Logo.JPG|center|Edinburgh University Logo]] <br />
<br />
== Welcome to the [http://www.ed.ac.uk University of Edinburgh ]==<br />
<br />
<h2>Project description</h2><br />
''Our team have designed and modelled an biosensor that can detect detect several different concentrations of arsenic and emit a pH signal in response. The device can detect the WHO guideline level of 10 ppb and the Bangladeshi standard of 50 ppb for arsenic in drinking water. A proof of concept Biobrick construct has shown a pH response to a concentration of arsenic of 5 ppb.''<br />
<br />
{| style="width:50%" border="0" cellspacing="0" cellpadding="5" align="right"|}<br />
<br />
<br />
{| border="0" cellspacing="5px" cellpadding="10" align="centre"<br />
<br />
| [[Image:teamphoto1.jpg|Edinburgh iGEM team|500 px]] <br />
<br />
''Left to Right (Back) - Hong Wu, Alistair, Bryony, Jen, Jelena, Chris;''<br />
<br />
''(Front) - Sree, Jude, Kim, Farid''<br />
<br />
|<h2>Team Members</h2> <br />
<br />
'''Biology'''<br />
<br />
[http://2006.igem.org/User:Judenich Judith Nicholson]<br />
<br />
[http://2006.igem.org/User:Fbizzari Farid Bizzari]<br />
<br />
[http://2006.igem.org/User:Jelena Jelena Aleksic]<br />
<br />
'''Informatics'''<br />
<br />
[http://2006.igem.org/User:Caiyizhi Yizhi Cai]<br />
<br />
[http://2006.igem.org/User:Sree Sreemati Lalgudi Seshasayee]<br />
<br />
[http://2006.igem.org/User:Ivakhno Sergii Ivakhno]<br />
<br />
'''Engineering'''<br />
<br />
[http://2006.igem.org/User:Bryonyd Bryony Davidson]<br />
<br />
[http://2006.igem.org/User:Jenwilson Jen Wilson]<br />
<br />
[http://2006.igem.org/User:Kim Kim de Mora]<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Faculty</h2><br />
[http://2006.igem.org/User:aelfick Alistair Elfick, Engineering]<br />
<br />
[http://2006.igem.org/User:Hongwu Hongwu Ma, Informatics]<br />
<br />
[http://2006.igem.org/User:cfrench Chris French, Biology]<br />
<br />
[http://2006.igem.org/User:Laszlo Laszlo Kozma-Bognar, Biology]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Projects</h2><br />
<br />
[http://2006.igem.org/Arsenic_Biosensor Arsenic Biosensor] <br />
<br />
[http://2006.igem.org/Biobricks Biobricks]<br />
<br />
[http://2006.igem.org/Standard_Protocols Standard Protocols]<br />
<br />
[http://2006.igem.org/EdinburghModeling Modeling]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Timeline</h2><br />
[http://2006.igem.org/Timeline Weekly Objectives] <br />
<br />
[http://2006.igem.org/Lab_Work Lab Work Biosensor]<br />
<br />
[http://2006.igem.org/Biosensor_Characterisation Biosensor Characterisation]<br />
<br />
[http://2006.igem.org/Lab_Work_3D_Structure_Builder Lab Work 3D Structure Builder] <br />
<br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Announcements</h2><br />
'''22-24/08/06''' Cambridge dined with us on the evening of the 22nd at a Chinese buffet restaurant, and then presentations were given the next morning by both teams.<br />
<br />
[http://2006.igem.org/Previous_announcements Previous announcements.]<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Links</h2><br />
<br />
[http://www.macteria.co.uk www.macteria.co.uk]<br />
<br />
[http://www.google.com/calendar/embed?src=9nbbaadui3ahqnmmbtl4cie4n8%40group.calendar.google.com Team Calendar]<br />
<br />
[http://groups.google.com/group/Ed-iGEM/ Discussion Board]<br />
<br />
[http://2006.igem.org/Useful_Reading Useful Reading]<br />
<br />
[http://2006.igem.org/Ideas Ideas]<br />
<br />
<br />
|width=240px style="padding: 5px|<br />
<br />
<h2>Gallery</h2><br />
[http://2006.igem.org/Edinburgh_Photos Team Photos]<br />
<br />
[http://2006.igem.org/Edinburgh_City Edinburgh]<br />
<br />
[http://2006.igem.org/Edinburgh_lab_photos Working hard]<br />
<br />
[http://2006.igem.org/Cambridge Cambridge photos]<br />
<br />
[http://2006.igem.org/promotional_material Promotional material]<br />
|}<br />
<br />
== Sponsors ==<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.gatsby.org.uk/ https://static.igem.org/mediawiki/2006/e/ed/Gatsby.GIF]<br />
|[http://www.royalcommission1851.org.uk/ https://static.igem.org/mediawiki/2006/7/71/RCE1851_2.jpg]<br />
||[http://www.bbsrc.ac.uk/ https://static.igem.org/mediawiki/2006/b/b8/Biotech.gif]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
|[http://www.epsrc.ac.uk/default.htm https://static.igem.org/mediawiki/2006/0/04/EPSRC1RGBLO.jpg]<br />
|[http://www.mathworks.com/ https://static.igem.org/mediawiki/2006/a/ae/MathWorks_Logo.JPG]<br />
|}<br />
<br />
{| border="0" cellspacing="0" cellpadding="5" align="center"<br />
||[http://www.syntheticbiology.ethz.ch/synbiocomm/index/ https://static.igem.org/mediawiki/2006/8/8f/Synbiocomm.jpg]<br />
|}<br />
<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/MinutesMinutes2006-10-25T09:34:14Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/University_of_Edinburgh_2006 Main page]<br />
<br />
==<font color='red'>Week 9: 14<sup>th</sup> - 18<sup>th</sup> August</font>==<br />
<br />
==Meeting - 15<sup>th</sup> August''==<br />
<br />
'''Wiki'''<br />
<br />
* Still need to fix the primers!<br />
<br />
<br />
'''Cambridge visit'''<br />
<br />
* Cambridge are coming from the 22<sup>nd</sup> to 24<sup>th</sup> August<br />
* Meal and drinks on Tuesday 22nd August followed by a ghost tour or a show<br />
* ICL aren’t coming<br />
<br />
<br />
'''Presentation'''<br />
<br />
* Need to make up a presentation – what’s been achieved since Cambridge visit<br />
* Make it about half an hour long<br />
<br />
* Characterisation experiments – Kim & Jen<br />
* Lab (AM) – Farid & Jude<br />
* Model – Patrick & Bryony<br />
<br />
* Send slides to Jen on Friday 18th August<br />
<br />
<br />
'''pH Turtle'''<br />
<br />
* Bryony will try & get a laptop as Chris’ other one didn’t work<br />
<br />
<br />
'''Modelling'''<br />
<br />
* Worked up from a molecular to a concentration basis<br />
* Want to correlate LacZ output with pH measured – need to add on reactions<br />
* Is it possible to model other components present in the media e.g. amino acids?<br />
* Have joined all three operons in the model<br />
* Have some results - see discussion board<br />
* pH shown to get very high when urease is switched on<br />
* Going to do parameter sensitivity analysis<br />
* Chris asked if it is possible to check model with any papers...<br />
<br />
<br />
'''Biobricks'''<br />
<br />
* ArsR with LacZ tests have been carried out<br />
* Arsenic doesn’t affect pH response – maybe LacZ is constantly on/problem with arsenic promoter?<br />
* Need to sequence – first must get preparation protocol from Jen or Chris<br />
* Plan was to combine LacZ and Lambda CI with arsenic promoter but not much point until we have a working arsenic promoter. Apparently the one we have used so far gives a very weak signal.<br />
<br />
* Chris has bacillus arsenic promoter bio-bricked. Farid is putting it into our e-coli.<br />
<br />
* Have urease to use with calcium phosphate. Is it biobricked?<br />
* Sree is going to design experiments and carry these out, probably in September<br />
<br />
<br />
'''Practical construction of working device'''<br />
<br />
* Make up 0.1M KCl buffer solution<br />
* Make up Buffer Z for ONTG LacZ assay<br />
<br />
* Come up with solid concept for device and then email Andrew Meharg (author of Venomous Earth) to ask his advice<br />
<br />
<br />
'''Website'''<br />
<br />
* Add other photos to gallery<br />
* Put up some significant results<br />
* Need to design Macteria mascot – have attempted this but it's awful!<br />
<br />
<br />
'''Visas'''<br />
<br />
* Sree, Patrick and Farid must get visas to go to USA. Involves making an appointment at the US embassy in either Belfast or London, getting a 9 day business visa which only allows visit to MIT and costs about £100.<br />
<br />
* Need to check requirements for UK citizen entry to USA.<br />
<br />
* Bryony might not be coming to MIT, depends on her PHD work.<br />
<br />
<br />
'''Miscellaneous'''<br />
<br />
* Bryony is aiming to finish by the end of this week<br />
* Sree can work September and October<br />
* Kim can work October<br />
<br />
<br />
<br />
==<font color='red'>Week 7: 31<sup>st</sup> July - 4<sup>th</sup> August</font>==<br />
<br />
==Meeting - 2<sup>nd</sup> August''==<br />
<br />
<br />
'''Wiki'''<br />
<br />
* Update Wiki re. primers for biobricks<br />
<br />
<br />
'''Tamara’s visit'''<br />
<br />
* Team meeting at 10am in Hons room on Tuesday 8th August<br />
* Construct an agenda for meeting<br />
* Show her round the labs<br />
* Attend a Fringe Festival show in the evening<br />
<br />
<br />
'''Cambridge visit'''<br />
<br />
* Best dates are 22<sup>nd</sup> to 24<sup>th</sup> August<br />
* Failing this, the start of September is okay<br />
* Jude currently has 3 spare rooms (possibly 4) from 22nd to 24th August<br />
* Invite ICL as well<br />
<br />
<br />
'''Holidays'''<br />
<br />
* Jude: 8<sup>th</sup> – 16<sup>th</sup> August <br />
* Laszlo: 8<sup>th</sup> – 22<sup>nd</sup> August<br />
* Sree: 24<sup>th</sup> – 25<sup>th</sup> August<br />
* Jelena: 27<sup>th</sup> August – 9<sup>th</sup> September<br />
* Kim: 8<sup>th</sup> – 28<sup>th</sup> September<br />
* Farid: ??? September <br />
* Bryony: ??? September<br />
<br />
<br />
'''pH Turtle'''<br />
<br />
* Currently not working. Chris suggests deleting mouse software from laptop. Will try this.<br />
<br />
<br />
'''Modelling'''<br />
<br />
* Meeting on Friday 4th August with Hong Wu<br />
<br />
<br />
'''Practical construction of working device'''<br />
<br />
* Kim has come up with lots of characterization experiments to be done in the lab next week once we have the arsenic-sensing device<br />
<br />
* Device might be ready on Friday 4th August<br />
<br />
* Email Andrew Meharg (author of Venomous Earth) to ask his advice on arsenic biosensing device<br />
<br />
<br />
'''Website'''<br />
<br />
* Do we need a disclaimer?<br />
<br />
* Need to design Macteria mascot – possibly ask the guy who did the cartoon for Drew and Endy (Nature website)!<br />
<br />
<br />
'''Biobricks'''<br />
<br />
* These can be added to the registry when they are ready (well done Jude who has done this before the minutes have been typed!)<br />
<br />
<br />
<br />
==<font color='red'>Week 5: 17<sup>th</sup> - 21<sup>st</sup> July</font>==<br />
<br />
==Meeting - 18<sup>th</sup> July''==<br />
<br />
<br />
'''Labwork on Arsenic Biosensor:'''<br />
<br />
''Biobricks''<br />
<br />
* PCR on arsenic and LacZ parts<br />
* 4 bands on gel from LacZ so need to find out which one is the correct one<br />
* Create sticky ends<br />
* Working towards arsenic device – may be ready in about 2 weeks<br />
<br />
''pH Experiments''<br />
<br />
* Want to measure population density at the point at which pH of blue and white E-Coli diverges <br />
* Difference between stationary and growth phase response is possibly due to the fact that the bacteria ‘want’ to use up the lactose when they’re in the growth phase<br />
* Ideal conditions for growth in LB have been established<br />
* Want to carry out experiments using different growth media<br />
<br />
<br />
'''Model'''<br />
<br />
* Plenty of info on Lac operon<br />
* Paper found regarding ArsR relation to arsenic concentration<br />
* Autoregulation – ArsR represses itself<br />
* Background noise may be caused due to degradation of ArsR repressor <br />
* Might be possible to reduce this background noise by separating the promoter from the ArsR gene<br />
* Need to calculate what pH from urea breakdown will be for different concentrations<br />
* It is thought to be necessary to have the two-part promoter (with activator and repressor binding sites) in order to prevent a build up of alkalinity which could harm the bacteria<br />
<br />
<br />
'''Wiki'''<br />
<br />
* Update biobricks<br />
<br />
<br />
'''Cambridge trip'''<br />
<br />
* Train leaves Edinburgh Waverley at 9.30am so try to be there by about 9am<br />
* Need to prepare a presentation (half an hour long)<br />
* Update animation of arsenic biosensor<br />
* Focus is arsenic project<br />
* Mention 3D structure builder briefly<br />
<br />
* Presentation layout<br />
** Background – Jelena<br />
** Building biobricks – Jude<br />
** pH experiment/animation – Kim<br />
** Modelling – Patrick<br />
<br />
<br />
'''Idea 6/11 – 3D structure builder'''<br />
<br />
* Primer design for urease<br />
* LacI biobrick – is it ok?<br />
<br />
<br />
'''To do'''<br />
<br />
* Moving all experiments to Andrew Miller’s lab<br />
* Meeting on Thursday at 2pm in Honours Room<br />
* Website development<br />
* Design a badge if you have a spare five minutes<br />
* Presentation completed<br />
<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/TimelineTimeline2006-10-25T09:33:58Z<p>Judenich: </p>
<hr />
<div>[http://2006.igem.org/Minutes Minutes]<br />
<br />
==<font color='red'>Week 10: 21<sup>th</sup> - 25<sup>th</sup> August</font>==<br />
<br />
#22nd-23rd: Meeting with Cambridge team<br />
#Finish presentation<br />
<br />
For the lab:<br />
#Get a working arsenic sensor. Obviously.<br />
#Have the constructs of arsR and lambda cI complete.<br />
#Site directed mutagenesis on the urease gene with the aim of making it into a biobrick<br />
#Possible construction of the hybrid promoter, if primers have arrived.<br />
<br />
==<font color='red'>Week 6: 24<sup>th</sup> - 28<sup>th</sup> July</font>==<br />
<br />
#24th-25th: Meeting with the Cambridge and Imperial teams at Cambridge.<br />
<br />
==<font color='red'>Week 5: 17<sup>th</sup> - 21<sup>st</sup> July</font>==<br />
<br />
#Cambridge presentation meeting thursday. The output from this will be a good layout for the presentation, which can be improved on friday.<br />
#PCR primers for Urease part ordered<br />
#Website host adress (www.macteria.co.uk) acquired<br />
#Batch of 50 badges made (so we can take them to cambridge)<br />
#"Turtle" characterised (if it arrives)<br />
#Investigate available growth mediums in preparation for further experimentation next week<br />
#Minipreps, digests and gels for cells transformed with (hopefully) biobricked arsenic and lacZ parts. <br />
#Joining of arsenic and lacZ parts, with a terminator, and transforming into E. coli<br />
<br />
==<font color='red'>Week 4: 10<sup>th</sup> - 14<sup>th</sup> July</font>==<br />
#Locate parts in the registry for the modelling of the arsenic biosensor and the 3D structure builder<br />
#Continuing in the lab with putting the arsR and new lacZ genes into biobrick constructs and trying to solve issues with isolating DNA fragments from gels<br />
#Devising new pH experiments to calibrate the sensor<br />
#Badge making, postcard making, locating possible people to send them to<br />
#Organising Cambridge trip<br />
#Initial modelling of the biosensor, finding out all the reactions involved and turning them into equations<br />
#Set up new website<br />
<br />
==<font color='red'>Week 3: 3<sup>rd</sup> - 7<sup>th</sup> July</font>==<br />
<br />
==='''<font color='blue'>Objectives for the arsenic sensor:</font>'''===<br />
<br />
<br />
Assess the effects of the: <br />
<br />
<br />
:1) bacterial population density on pH<br />
<br />
:2) growth phase on pH change<br />
<br />
:3) concentration of lactose on pH<br />
<br />
:4) time on pH<br />
<br />
<br />
All effects are to be measured on the pH of the liquid cultures with the Lacz deficient strain of E-coli.<br />
<br />
Due to problems in the lab, the above objectives are revised to next week. These problems are illustrated in the [http://2006.igem.org/Lab_Work Lab work section]. Objectives for this week are now to get the first PCR primers made to assemble our first biobricks. Tests for the production of lactic acid on L-agar plates using the LacZ plasmids should be started tomorrow afternoon after the lecture from Dr Elfick.<br />
<br />
==='''<font color='blue'>Objectives for the 3d structure builder:</font>'''===<br />
<br />
<br />
1) Determine whether to use the Urease or Phosphatase enzyme to precipitate a solid substrate<br />
<br />
==<font color='red'>Week 2: 26<sup>th</sup> - 30<sup>th</sup> June</font>==<br />
<br />
More Brainstorming<br />
<br />
==<font color='red'>Week 1: 19<sup>th</sup> - 23<sup>rd</sup> June</font>==<br />
<br />
Brainstorming<br />
<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/BiobricksBiobricks2006-10-25T09:31:42Z<p>Judenich: </p>
<hr />
<div>== Construction So Far ==<br />
<br />
=== Devices Created ===<br />
{| border="1"<br />
|-<br />
| '''Parts''' || '''Part No.''' || '''Function''' || '''Status'''<br />
|-<br />
| E. coli ArsR to LacZ || J33203 || pH lowering output in response to raised arsenate concentration || Not Working<br />
|- <br />
| B. subtilis ArsR to LacZ || J33206 || As Above || Doing again with correct lacZ<br />
|-<br />
| B. subtilis ArsR to lambda cI repressor || n/a|| To repress the hybrid promoter in response to lower levels of arsenate || Done but untested<br />
|-<br />
| GFP to Terminator || n/a || Testing ArsR function if can't get pH response || Done but not ligated to either ArsR<br />
|-<br />
|}<br />
<br />
=== Biobricks Constructed By Us ===<br />
{| border="1"<br />
|-<br />
| '''Biobrick''' || '''Part No.''' || '''Construction''' || '''Ligations''' || '''Testing''' || '''Sequencing''' || '''Use'''<br />
|-<br />
| E. coli ArsR || J33201 || Complete || To LacZ || Working || Done || Detection of Arsenic<br />
|-<br />
| B. subtilis ArsR || n/a || Complete || To LacZ || Tests Underway || SpeI site not correct, not in biobrick form || Detection of Arsenic<br />
|-<br />
| LacZ' || J33202 || Complete || To ArsR and Terminator || Working || Done || Lowering pH/Reporting<br />
|-<br />
| Bacillus Urease || n/a || Site specific mutagenesis required || To ligate to hybrid promoter || N/A || Not Yet || Raising pH<br />
|-<br />
| lambda cI/lacI Promoter || J33205 || Complete || To ligate to urease || Planned || Done || Repressed by lambda cI and lacI in absence of lactose<br />
|- <br />
|}<br />
=== Parts constructed but not used ===<br />
{| border="1"<br />
|-<br />
| '''Biobrick''' || '''Part No.''' || '''Function''' ||<br />
|-<br />
| xylE from Psuedomonas putida || J33204 || Reporter converting catechol to yellow colour<br />
|-<br />
|}<br />
<br />
<br />
=== Biobricks Taken From Registry ===<br />
{| border="1"<br />
|-<br />
| '''Biobrick''' || '''Number and Location''' || '''Ligations''' || '''Testing''' || '''Use'''<br />
|-<br />
| Terminator || BBa_B0015, 1I || To LacZ, plasmid used as vector for most ligations || N/A || Terminating<br />
|-<br />
| RBS || BBa_B0034, 3O || To ArsR from E. coli || N/A || Ribosome binding site<br />
|-<br />
| lambda cI || BBa_R0051, 9C || Not yet || Not yet || Repressing hybrid promoter<br />
|-<br />
| GFP || BBa_E0040, 5H || To Terminator || Not Yet || Testing Promoters<br />
|-<br />
|}<br />
<br />
== Primers Etc. ==<br />
<br />
All biobricks have to have the following:<br />
<br />
''Prefix'' <br />
<br />
(5’) <font color='red'> cctttctagag </font> (3’)<br />
<br />
''Suffix'' <br />
<br />
(5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’)<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/BiobricksBiobricks2006-10-25T09:28:58Z<p>Judenich: </p>
<hr />
<div>== Construction So Far ==<br />
<br />
=== Devices Created ===<br />
{| border="1"<br />
|-<br />
| '''Parts''' || '''Part No.''' || '''Function''' || '''Status'''<br />
|-<br />
| E. coli ArsR to LacZ || J33203 || pH lowering output in response to raised arsenate concentration || Not Working<br />
|- <br />
| B. subtilis ArsR to LacZ || J33206 || As Above || Doing again with correct lacZ<br />
|-<br />
| B. subtilis ArsR to lambda cI repressor || n/a|| To repress the hybrid promoter in response to lower levels of arsenate || Done but untested<br />
|-<br />
| GFP to Terminator || n/a || Testing ArsR function if can't get pH response || Done but not ligated to either ArsR<br />
|-<br />
|}<br />
<br />
=== Biobricks Constructed By Us ===<br />
{| border="1"<br />
|-<br />
| '''Biobrick''' || '''Part No.''' || '''Construction''' || '''Ligations''' || '''Testing''' || '''Sequencing''' || '''Use'''<br />
|-<br />
| E. coli ArsR || J33201 || Complete || To LacZ || Working || Done || Detection of Arsenic<br />
|-<br />
| B. subtilis ArsR || n/a || Complete || To LacZ || Tests Underway || SpeI site not correct, not in biobrick form || Detection of Arsenic<br />
|-<br />
| LacZ' || J33202 || Complete || To ArsR and Terminator || Working || Done || Lowering pH/Reporting<br />
|-<br />
| Bacillus Urease || n/a || Site specific mutagenesis required || To ligate to hybrid promoter || N/A || Not Yet || Raising pH<br />
|-<br />
| lambda cI/lacI Promoter || J33205 || Complete || To ligate to urease || Planned || Done || Repressed by lambda cI and lacI in absence of lactose<br />
|- <br />
|}<br />
=== Parts constructed but not used ===<br />
{| border="1"<br />
|-<br />
| '''Biobrick''' || '''Function'''<br />
<br />
<br />
=== Biobricks Taken From Registry ===<br />
{| border="1"<br />
|-<br />
| '''Biobrick''' || '''Number and Location''' || '''Ligations''' || '''Testing''' || '''Use'''<br />
|-<br />
| Terminator || BBa_B0015, 1I || To LacZ, plasmid used as vector for most ligations || N/A || Terminating<br />
|-<br />
| RBS || BBa_B0034, 3O || To ArsR from E. coli || N/A || Ribosome binding site<br />
|-<br />
| lambda cI || BBa_R0051, 9C || Not yet || Not yet || Repressing hybrid promoter<br />
|-<br />
| GFP || BBa_E0040, 5H || To Terminator || Not Yet || Testing Promoters<br />
|-<br />
|}<br />
<br />
== Primers Etc. ==<br />
<br />
All biobricks have to have the following:<br />
<br />
''Prefix'' <br />
<br />
(5’) <font color='red'> cctttctagag </font> (3’)<br />
<br />
''Suffix'' <br />
<br />
(5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’)<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/BiobricksBiobricks2006-10-23T11:57:23Z<p>Judenich: /* Biobricks Constructed By Us */</p>
<hr />
<div>== Construction So Far ==<br />
<br />
=== Devices Created ===<br />
{| border="1"<br />
|-<br />
| '''Parts''' || '''Function''' || '''Status'''<br />
|-<br />
| E. coli ArsR to LacZ || pH lowering output in response to raised arsenate concentration || Not Working<br />
|- <br />
| B. subtilis ArsR to LacZ || As Above || Doing again with correct lacZ<br />
|-<br />
| B. subtilis ArsR to lambda cI repressor || To repress the hybrid promoter in response to lower levels of arsenate || Done but untested<br />
|-<br />
| GFP to Terminator || Testing ArsR function if can't get pH response || Done but not ligated to either ArsR<br />
|-<br />
|}<br />
<br />
=== Biobricks Constructed By Us ===<br />
{| border="1"<br />
|-<br />
| '''Biobrick''' || '''Construction''' || '''Ligations''' || '''Testing''' || '''Sequencing''' || '''Use'''<br />
|-<br />
| E. coli ArsR || Complete || To LacZ || Working || Done || Detection of Arsenic<br />
|-<br />
| B. subtilis ArsR || Complete || To LacZ || Tests Underway || Done || Detection of Arsenic<br />
|-<br />
| LacZ || Complete || To ArsR and Terminator || Working || Done || Lowering pH/Reporting<br />
|-<br />
| Bacillus Urease || Site specific mutagenesis required || To ligate to hybrid promoter || N/A || Not Yet || Raising pH<br />
|-<br />
| lambda cI/lacI Promoter || Complete || To ligate to urease || Planned || Done || Repressed by lambda cI and lacI in absence of lactose<br />
|- <br />
|}<br />
<br />
=== Biobricks Taken From Registry ===<br />
{| border="1"<br />
|-<br />
| '''Biobrick''' || '''Number and Location''' || '''Ligations''' || '''Testing''' || '''Use'''<br />
|-<br />
| Terminator || BBa_B0015, 1I || To LacZ, plasmid used as vector for most ligations || N/A || Terminating<br />
|-<br />
| RBS || BBa_B0034, 3O || To ArsR from E. coli || N/A || Ribosome binding site<br />
|-<br />
| lambda cI || BBa_R0051, 9C || Not yet || Not yet || Repressing hybrid promoter<br />
|-<br />
| GFP || BBa_E0040, 5H || To Terminator || Not Yet || Testing Promoters<br />
|-<br />
|}<br />
<br />
== Primers Etc. ==<br />
<br />
All biobricks have to have the following:<br />
<br />
''Prefix'' <br />
<br />
(5’) <font color='red'> cctttctagag </font> (3’)<br />
<br />
''Suffix'' <br />
<br />
(5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’)<br />
<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]<br />
__NOTOC__</div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:50:46Z<p>Judenich: /* Interests */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== About Me ==<br />
[[Image:summermeadow.jpg|256px|thumb|left|What I Do In Edinburgh In Summer]]<br />
[[Image:winterarthur.jpg|256px|thumb|right|What I Do In Edinburgh In Winter]]<br />
<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, sitting on the meadows of a lovely warm(ish!) Edinburgh evening, and I am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
Find me on [http://www.facebook.com Facebook]<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:45:07Z<p>Judenich: /* Interests */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== Interests ==<br />
[[Image:summermeadow.jpg|256px|thumb|left|What I Do In Edinburgh In Summer]]<br />
[[Image:winterarthur.jpg|256px|thumb|right|What I Do In Edinburgh In Winter]]<br />
<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, sitting on the meadows of a lovely warm(ish!) Edinburgh evening, and I am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
Find me on [http://www.facebook.com Facebook]<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:44:57Z<p>Judenich: /* Interests */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== Interests ==<br />
[[Image:summermeadow.jpg|256px|thumb|left|What I Do In Edinburgh In Summer]]<br />
[[Image:winterarthur.jpg|256px|thumb|right|What I Do In Edinburgh In Winter]]<br />
<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
[[Image:winterarthur.jpg|256px|thumb|right|What I Do In Edinburgh In Winter]]<br />
<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, sitting on the meadows of a lovely warm(ish!) Edinburgh evening, and I am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
Find me on [http://www.facebook.com Facebook]<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:44:36Z<p>Judenich: /* Interests */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== Interests ==<br />
[[Image:summermeadow.jpg|256px|thumb|left|What I Do In Edinburgh In Summer]]<br />
<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
[[Image:winterarthur.jpg|256px|thumb|right|What I Do In Edinburgh In Winter]]<br />
<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, sitting on the meadows of a lovely warm(ish!) Edinburgh evening, and I am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
Find me on [http://www.facebook.com Facebook]<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:44:14Z<p>Judenich: /* Interests */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== Interests ==<br />
[[Image:summermeadow.jpg|256px|thumb|left|What I Do In Edinburgh In Summer]]<br />
<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
<br />
[[Image:winterarthur.jpg|256px|thumb|right|What I Do In Edinburgh In Winter]]<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, sitting on the meadows of a lovely warm(ish!) Edinburgh evening, and I am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
Find me on [http://www.facebook.com Facebook]<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:43:58Z<p>Judenich: /* Interests */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== Interests ==<br />
[[Image:summermeadow.jpg|256px|thumb|left|What I Do In Edinburgh In Summer]]<br />
<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
<br />
[[Image:winterarthur.jpg|256px|thumb|left|What I Do In Edinburgh In Winter]]<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, sitting on the meadows of a lovely warm(ish!) Edinburgh evening, and I am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
Find me on [http://www.facebook.com Facebook]<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:43:12Z<p>Judenich: /* Interests */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== Interests ==<br />
[[Image:summermeadow.JPG|256px|thumb|left|What I Do In Edinburgh In Summer]]<br />
<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
<br />
[[Image:winterarthur.JPG|256px|thumb|left|What I Do In Edinburgh In Winter]]<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, sitting on the meadows of a lovely warm(ish!) Edinburgh evening, and I am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
Find me on [http://www.facebook.com Facebook]<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/File:Winterarthur.jpgFile:Winterarthur.jpg2006-10-23T11:41:45Z<p>Judenich: </p>
<hr />
<div></div>Judenichhttp://2006.igem.org/wiki/index.php/File:Summermeadow.jpgFile:Summermeadow.jpg2006-10-23T11:41:25Z<p>Judenich: </p>
<hr />
<div></div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:40:17Z<p>Judenich: /* Interests */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== Interests ==<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, sitting on the meadows of a lovely warm(ish!) Edinburgh evening, and I am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
Find me on [http://www.facebook.com Facebook]<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:32:55Z<p>Judenich: /* Contact */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== Interests ==<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, and am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
Find me on [http://www.facebook.com Facebook]<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenichhttp://2006.igem.org/wiki/index.php/User:JudenichUser:Judenich2006-10-23T11:32:16Z<p>Judenich: /* Contact */</p>
<hr />
<div>== Judith Nicholson ==<br />
[[Image:Jude.JPG|Jude]]<br />
<br />
I am a fourth year biochemistry undergraduate at Edinburgh University, and am originally from Easington Colliery in County Durham.<br />
<br />
== Interests ==<br />
When I'm not working hard for iGEM, you can generally find me in the pub or at my flat watching Quincy or [http://www.bbc.co.uk/drama/neighbours/games/foodflingingfrenzy/ Neighbours] with my nose in a book, usually something Russian and gloomy. I also spend a lot of time listening to music, making tapes, going to see bands.<br />
<br />
I had an excellent time this summer working on our project, as well as having a bit too much fun at the Edinburgh Festival, having a quick holiday in Belgrade, and am looking forward to finishing it all with a bit of a party in November!<br />
<br />
== Contact ==<br />
'''e-mail''' - s0347129@sms.ed.ac.uk<br />
<br />
__NOTOC__<br />
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]</div>Judenich