Primers for Hin gene with LVA degredation tag
From 2006.igem.org
(Difference between revisions)
Fizzle6821 (Talk | contribs) |
Fizzle6821 (Talk | contribs) |
||
| (4 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
| - | '''''Hin gene with LVA degredation tag''''' | + | '''''Hin gene with LVA degredation tag Part BBa_J31001[http://partsregistry.org/Part:BBa_J31001]''''' |
| - | Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. | + | Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. PCR using these primers should take place after the Mutant Hin has already been transformed. |
'''Forward Primer''' | '''Forward Primer''' | ||
| - | *Consists of | + | *Consists of <font color='blue'>four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2]</font color><font color='green'>BioBrick prefix</font color>, and<font color='orange'> the first three base pairs of the Hin gene</font color>[http://partsregistry.org/Part:pSB1A2] |
| + | |||
| + | 5'-->3' | ||
| + | |||
<font face="courier new"><font color='blue'>TCTG</font color><font color='green'>GAATTCGCGGCCGCATCTAGAG</font color><font color='orange'>ATG</font color></font face> | <font face="courier new"><font color='blue'>TCTG</font color><font color='green'>GAATTCGCGGCCGCATCTAGAG</font color><font color='orange'>ATG</font color></font face> | ||
'''''Reverse Primer''''' | '''''Reverse Primer''''' | ||
*Consists of the <font color='green'>Bio Brick suffix</font color>,<font color='red'> Stop codon</font color>, <font color='purple'>LVA tag</font color> and the ,<font color='orange'>last 20 base pairs of the Hin gene</font color> (without the stop codon) | *Consists of the <font color='green'>Bio Brick suffix</font color>,<font color='red'> Stop codon</font color>, <font color='purple'>LVA tag</font color> and the ,<font color='orange'>last 20 base pairs of the Hin gene</font color> (without the stop codon) | ||
| + | |||
| + | 5'-->3' | ||
<font face="courier new"><font color='green'>CTGCAGGCGGCCGCTACTAGT</font color><font color='red'>ATT</font color><font color='purple'>AAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC</font color><font color='orange'>ATTCATTCGTTTTTTTATAC</font color></font face> | <font face="courier new"><font color='green'>CTGCAGGCGGCCGCTACTAGT</font color><font color='red'>ATT</font color><font color='purple'>AAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC</font color><font color='orange'>ATTCATTCGTTTTTTTATAC</font color></font face> | ||
Latest revision as of 15:19, 31 July 2006
Hin gene with LVA degredation tag Part BBa_J31001[http://partsregistry.org/Part:BBa_J31001]
Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. PCR using these primers should take place after the Mutant Hin has already been transformed.
Forward Primer
- Consists of four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2]BioBrick prefix, and the first three base pairs of the Hin gene[http://partsregistry.org/Part:pSB1A2]
5'-->3'
TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse Primer
- Consists of the Bio Brick suffix, Stop codon, LVA tag and the ,last 20 base pairs of the Hin gene (without the stop codon)
5'-->3'
CTGCAGGCGGCCGCTACTAGTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC
