IGEM 2005 Awards
From 2006.igem.org
(Difference between revisions)
Line 11: | Line 11: | ||
**Feynman's Teaching Award | **Feynman's Teaching Award | ||
- | + | *ETH | |
- | + | **Best Wiki Award | |
- | + | **Most Sensitive Super Model Award | |
- | + | **Precision Engineering Award | |
- | + | *MIT | |
- | + | **Most Modest Goal | |
- | + | **Least Transportable Visual Aid | |
- | + | **Best Analogy | |
- | + | **Second Most Parts Award | |
- | + | *Caltech | |
- | + | **Best Use of Transmogrified Smiley Faces | |
- | + | **Best New Application Area | |
- | + | **Best New New Foundational Research Area | |
- | + | **Chuck D.'s Choice Award | |
- | + | *Toronto | |
- | + | **Best Project Name (Cell-See-Us) | |
- | + | **Most Direct Use of Logic | |
- | + | **Best Advice | |
- | + | **Nothing-Will-Stop-Us Award | |
- | + | *Cambridge | |
- | + | **Most Effective Approach | |
- | + | **Best Master of Ceremonies | |
- | + | **Marshall Cultural Exchange Award | |
- | + | **Best Data & Data Visuals | |
- | + | **Best Uniforms | |
- | + | *Texas | |
- | + | **Best Confession / Negative Control (One Year Late) | |
- | + | **Best Live Demo, Again | |
- | + | **Best Model-Driven Design | |
- | + | **Best Proposed Funding Mechanism | |
- | + | *Penn State | |
- | + | **Best Brick Award (BBa_S03271, MotB) | |
- | + | **Best New Sport (Beijing 2008 or bust!) | |
- | + | **Best Use of Metaphor | |
- | + | *Berkeley | |
- | + | **Red-Eye Award | |
- | + | **XXXtreme Presentation | |
- | + | **Best Conceptual Advance | |
- | + | **Most Innovative Brick Award (BBa_J01002) | |
- | + | *Davidson | |
- | + | **Best Team Name (SynthAces) | |
- | + | **Best Debuggers | |
- | + | **Best Interface Logic | |
- | + | *Harvard | |
- | + | **Best Part Numbers | |
- | + | **Most Organized Presentation | |
- | + | **Best Technology Integration Award | |
- | + | **Most Parts Award | |
- | + | **Best TAATACGACTCACTATAGGGAGA Award | |
- | + | **Best Use of Redundancy | |
- | + | *UCSF | |
- | + | **Coolest Part | |
- | + | **Most Innovative Abuse of Expensive Laboratory Equipment | |
- | + | **Best Device Award | |
- | + | **Most Thoughtful Approach | |
==Highlights (some of the things that worked)== | ==Highlights (some of the things that worked)== | ||
- | + | *Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch) | |
- | + | *Texas - Working and improved bacterial photography and signal processing device (built from BioBricks) | |
- | + | *Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet) | |
- | + | *MIT - Iron-induced control of any BioBrick device | |
- | + | *Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB) | |
- | + | *Harvard - write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires." | |
- | + | *UCSF - wanted biological temperature detector, got a programmable biological thermometer |
Revision as of 16:17, 7 November 2005
The following awards were given out at the 2005 Jamboree
- Princeton
- Best Plasmid Naming Scheme
- Best "Show Must Go On" Moment
- Best Honest Answer
- Best Simulation of a Simulation
- Oklahoma
- Best "Hail Mary" Cloning
- Best "Quantitative" Answer
- Feynman's Teaching Award
- ETH
- Best Wiki Award
- Most Sensitive Super Model Award
- Precision Engineering Award
- MIT
- Most Modest Goal
- Least Transportable Visual Aid
- Best Analogy
- Second Most Parts Award
- Caltech
- Best Use of Transmogrified Smiley Faces
- Best New Application Area
- Best New New Foundational Research Area
- Chuck D.'s Choice Award
- Toronto
- Best Project Name (Cell-See-Us)
- Most Direct Use of Logic
- Best Advice
- Nothing-Will-Stop-Us Award
- Cambridge
- Most Effective Approach
- Best Master of Ceremonies
- Marshall Cultural Exchange Award
- Best Data & Data Visuals
- Best Uniforms
- Texas
- Best Confession / Negative Control (One Year Late)
- Best Live Demo, Again
- Best Model-Driven Design
- Best Proposed Funding Mechanism
- Penn State
- Best Brick Award (BBa_S03271, MotB)
- Best New Sport (Beijing 2008 or bust!)
- Best Use of Metaphor
- Berkeley
- Red-Eye Award
- XXXtreme Presentation
- Best Conceptual Advance
- Most Innovative Brick Award (BBa_J01002)
- Davidson
- Best Team Name (SynthAces)
- Best Debuggers
- Best Interface Logic
- Harvard
- Best Part Numbers
- Most Organized Presentation
- Best Technology Integration Award
- Most Parts Award
- Best TAATACGACTCACTATAGGGAGA Award
- Best Use of Redundancy
- UCSF
- Coolest Part
- Most Innovative Abuse of Expensive Laboratory Equipment
- Best Device Award
- Most Thoughtful Approach
Highlights (some of the things that worked)
- Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
- Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
- Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
- MIT - Iron-induced control of any BioBrick device
- Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
- Harvard - write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
- UCSF - wanted biological temperature detector, got a programmable biological thermometer