Biobricks
From 2006.igem.org
(Difference between revisions)
| Line 1: | Line 1: | ||
== Construction So Far == | == Construction So Far == | ||
| - | === | + | === Devices Created === |
{| border="1" | {| border="1" | ||
|- | |- | ||
Revision as of 10:37, 21 August 2006
Construction So Far
Devices Created
| Parts | Function | Status |
| E. coli ArsR to LacZ | pH lowering output in response to raised arsenate concentration | Not Working |
| B. subtilis ArsR to LacZ | As Above | Not tested |
| B. subtilis ArsR to lambda cI repressor | To repress the hybrid promoter in response to lower levels of arsenate | Needs to be done again with RBS |
Biobricks Constructed By Us
| Biobrick | Construction | Ligations | Testing | Sequencing | Use |
| E. coli ArsR | Complete | To LacZ | Not Working | Not Yet | Detection of Arsenic |
| B. subtilis ArsR | Complete | To LacZ | Not Tested | Not Yet | Detection of Arsenic |
| LacZ | Complete | To ArsR and Terminator | Tests Underway | Not Yet | Lowering pH/Reporting |
| Bacillus Urease | Site specific mutagenesis required | To ligate to hybrid promoter | N/A | Not Yet | Raising pH |
| lambda cI/lacI Promoter | Underway | To ligate to urease | N/A | Not yet | Repressed by lambda cI and lacI in absence of lactose |
Biobricks Taken From Registry
| Biobrick | Number and Location | Ligations | Testing | Use |
| Terminator | BBa_B0015, 1I | To LacZ, plasmid used as vector for most ligations | N/A | Terminating |
| RBS | BBa_B0034, 3O | To ArsR from E. coli | N/A | Ribosome binding site |
| lambda cI | BBa_R0051, 9C | Not yet | Not yet | Repressing hybrid promoter |
Primers Etc.
All biobricks have to have the following:
Prefix
(5’) cctttctagag (3’)
Suffix
(5’) tactagtagcggccgctgcagcctt (3’)
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]
