Primers for Hin gene with LVA degredation tag
From 2006.igem.org
(Difference between revisions)
Fizzle6821 (Talk | contribs) |
|||
Line 1: | Line 1: | ||
'''''Hin gene with LVA degredation tag''''' | '''''Hin gene with LVA degredation tag''''' | ||
- | Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. | + | Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. PCR using these primers should take place after the Mutant Hin has already been transformed. |
'''Forward Primer''' | '''Forward Primer''' |
Revision as of 18:36, 12 June 2006
Hin gene with LVA degredation tag
Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. PCR using these primers should take place after the Mutant Hin has already been transformed.
Forward Primer
- Consists of a BioBrick prefix, four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2], and the first three base pairs of the Hin gene[http://partsregistry.org/Part:pSB1A2]
TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse Primer
- Consists of the Bio Brick suffix, Stop codon, LVA tag and the ,last 20 base pairs of the Hin gene (without the stop codon)
CTGCAGGCGGCCGCTACTAGTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC