BU06:Team C

Members

Meeting Schedule

Wednesday July 12th, 3pm Ingalls

• Goal: Present info on how to isolate from plasmid, how to PCR and add ends, and protocol/primer design
  • I posted a list of links to websites with protocols which should be helpful in designing a plan for our project. This week everyone should look through the websites and become familiar with some of the techniques. Try to create a rough outline of how to approach the experiment and what steps need to be taken from start to end. We have the [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=155405 sequence] for our luxCDABE operon, and we have identified AgeI as the restriction site that we will use in doing the PCR reaction. If you copy the sequence into NEB Cutter (link below) you can see where all of the restrition sites are, including AgeI. Start to think about how we would design primers and maybe even give it a shot. Feel free to post anything you find or any questions you encounter on the wiki so that we can use it as a forum for ideas and progress. You can also e-mail any questions or ideas to me and i'll put it up on the wiki. We'll meet to go over everything that we have found out this week and then present our progress at the general meeting.

Current Progress

• Isolation of luxCDABE:The luxCDABE operon has been designed such that it can be removed from the pUC19 plasmid by EcoRI sites that are at the very beginning and ends. This makes it easy to isolate the operon from pUC19 in order to add the restriction sites to the ends.
• Adding Ends: PCR is one way to add restriction sites onto the ends of a sequence. Primers can be designed which will anneal to the gene, yet have an overhang which includes the restriction site(s). The problem arises in the length of our operon. At nearly 7000bp, the operon is too long for PCR to amplify all of it (standard PCR is only efficient up to about 5000bp according to our PCR master mix). Therefore, the PCR reaction must be preformed in different parts, cut with a restriction enzyme in the middle and ligated into one piece. We will use the AgeI restriction site in the middle where two PCR reactions will overlap.
  • End Sequences: The sequences which we need to add to the beginning and ends of the operon can be found in the registry. Part [http://partsregistry.org/Part:BBa_G00000| BBa_G00000] is the prefix sequence, and part [http://partsregistry.org/Part:BBa_G00001| BBa_G00001] is the suffix sequence.

GAATTCGCGGCCGCTTCTAGAG
EcoRI site found in the sequence at base pair 1.
XbaI site found in the sequence at base pair 16.
NotI site found in the sequence at base pair 7.

TACTAGTAGCGGCCGCTGCAG
SpeI site found in the sequence at base pair 2.
PstI site found in the sequence at base pair 16.
NotI site found in the sequence at base pair 9.

[http://people.bu.edu/mkinney/protocols.pdf Experiment Design and Protocols (pdf)]

Questions

• How can we test if the restriction sites have been added successfully?
• Do we actually need to cut the operon out of the plasmid or can we just directly PCR from the plasmid?

References

Techniques

• [http://www.openwetware.org/wiki/Designing_primers Designing Primers]
• [http://www.mcb.uct.ac.za/pcroptim.htm More Info on Primer Design]

Protocols

• [http://www1.qiagen.com/literature/BenchGuide/pdf/1017778_BenchGuide.pdf Qigaen Bench Guide] - Very good general overview of protocols
• [http://www.openwetware.org/wiki/Agarose_gel_electrophoresis Agarose Gel Electrophoresis]
• [http://www.openwetware.org/wiki/DNA_Ligation DNA Ligation]
• [http://www.openwetware.org/wiki/Miniprep/Qiagen_kit Miniprep]
• [http://www.uark.edu/ua/henrylab/Links/biochemgen/QIAquick_spin.pdf QIAquick Spin Handbook] - For PCR purification and gel extraction
• [http://www.openwetware.org/wiki/Restriction_digest Restriction Digest]

Tools